{"data":{"solutions":[{"title":"title9x","id":"3009678","created":"1370836123","body":"No comment","sequence":"GGAAAGCAGUAUAGAAAUAUACAAGCCCGAAAGGAUACUGAAAAGUAAGCUAAGCAAGGUGAAAAUCAGUUUUGAUUCGUCGAAACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"stlnegril9","uid":"53165","picture":"","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"2","gc":"11","au":"13","meltpoint":"77.00","energy":"-23.9","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"title9","id":"3009662","created":"1370835992","body":"No comment","sequence":"GGAAAGCAGUAUAGAAAUAUACAAGCCCGAAAGGAUAAUGAAAAUUAAGCUAAGCAAGGUGAAAAUCAGUAUUGAUUCGUCGAUACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"stlnegril9","uid":"53165","picture":"","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"2","gc":"10","au":"14","meltpoint":"77.00","energy":"-22.2","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"ttitle","id":"3009653","created":"1370835873","body":"No comment","sequence":"GGAAAGCAGUAUAGAAAUAUACAAGCCCGAAAGGAUUAUGAAAAUAAAGCUAAGCAAGUUGAAAAGCAGUAUUCAUUCGUGGAUACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"stlnegril9","uid":"53165","picture":"","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"2","gc":"10","au":"14","meltpoint":"77.00","energy":"-22.2","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Super GAAAH!","id":"3009213","created":"1370831196","body":"Another variation of my original GAAAH Loop","sequence":"GGAAAGCGGUAUCGAAAGAUACAGGCGCGAAAGCAGCACGAAAGUGCAGCCAAGCAAGUCGAAAGACAGCAACACUUCGGUGUUGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"janetmason","uid":"56579","picture":"sites\/default\/files\/pictures\/picture-56579.png","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"18","au":"8","meltpoint":"97.00","energy":"-48.3","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"LROppy The GAAA loop 03 mod Fisker","id":"3006882","created":"1370811947","body":"Clean dot plot.","sequence":"GGAAACCAGUACCGAAAGGUACAGCCGCGAAAGCAGAUCGAAAGAUCAGGCAAGGAAGCCGAAAGGCAGCGUCUCUUCGGAGACGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"lroppy","uid":"2804","picture":"sites\/default\/files\/pictures\/picture-2804.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"20","au":"6","meltpoint":"107.00","energy":"-52.2","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"LROppy The GAAA loop 02 mod Jieux","id":"3006874","created":"1370811884","body":"Clean dot plot.","sequence":"GGAAAGCAGUGACGAAAGUCACAGAGGCGAAAGCAGUGCGAAAGCACACUCAAGCAAGAGGAAACUCAGGUGCCGUUCGCGGCGCCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"lroppy","uid":"2804","picture":"sites\/default\/files\/pictures\/picture-2804.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"1","gc":"20","au":"5","meltpoint":"107.00","energy":"-48.9","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"LROppy The GAAA loop 01","id":"3006847","created":"1370811688","body":"Trying parallel GC to close them. Clean dot plot.","sequence":"GGAAAGGAGAUCCGAAAGGAUCAGCCGGGAAACCAGUCCGAAAGGACAGGCAACCAAGCCGAAAGGCAGUCUGCCUUCGGGCAGACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"lroppy","uid":"2804","picture":"sites\/default\/files\/pictures\/picture-2804.jpg","synthesis-score":"82","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"21","au":"5","meltpoint":"107.00","energy":"-55.1","has-fold-data":"0","SHAPE":"1, 0.6876, 0.9832, 0.9391, 0.6514, 0.2781, 0, 0.3689, 0.2756, 0, 0, 0.0918, 0, 0.0183, 0.3832, 0.4713, 0.1989, 0.2881, 0.0899, 0.1794, 0, 0.0299, 0.2531, 1.5717, 0.0869, 0, 0.0868, 0.2594, 0.2585, 0.1796, 0.6795, 0.4222, 0.6692, 0.0836, 0.3327, 0.2486, 0.1654, 0, 0, 0.0826, 0.1648, 0.2467, 0.3263, 0.1628, 0.1624, 0, 0, 0.162, 0.3226, -0.0821, 0, 0.4271, 0.4246, 0.3433, 0.2369, 0.1522, 0.6236, 0.9992, 0.2963, 0.3042, 0, 0.076, 0.453, 0.1507, 0.0753, 0.0752, 0.0751, 0.2246, 0.4464, 0.2964, 0.2216, 0, 0.0738, 0.1473, 0.0736, 0.22, 0.4374, 0, 0.218, 0, 0","SHAPE-threshold":"0.225","SHAPE-max":"0.413","SHAPE-min":"0.038","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.038,\"max\":0.413,\"threshold\":0.225,\"peaks\":[0.6876,0.9832,0.9391,0.6514,0.2781,0,0.3689,0.2756,0,0,0.0918,0,0.0183,0.3832,0.4713,0.1989,0.2881,0.0899,0.1794,0,0.0299,0.2531,1.5717,0.0869,0,0.0868,0.2594,0.2585,0.1796,0.6795,0.4222,0.6692,0.0836,0.3327,0.2486,0.1654,0,0,0.0826,0.1648,0.2467,0.3263,0.1628,0.1624,0,0,0.162,0.3226,-0.0821,0,0.4271,0.4246,0.3433,0.2369,0.1522,0.6236,0.9992,0.2963,0.3042,0,0.076,0.453,0.1507,0.0753,0.0752,0.0751,0.2246,0.4464,0.2964,0.2216,0,0.0738,0.1473,0.0736,0.22,0.4374,0,0.218,0,0]}]"},{"title":"First try","id":"3006312","created":"1370808405","body":"No comment","sequence":"GGAAAGCAGAGUGGAAACAUUCAGUCGGGAAACCAGAUGGAAACGUCAGACACGCGACAGGAAACUGGGUCGUACUUCGGUGCGGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Whitecrow","uid":"100597","picture":"","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"4","gc":"16","au":"6","meltpoint":"107.00","energy":"-42.7","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"g3a-9","id":"3005330","created":"1370799526","body":"No comment","sequence":"GGAAACCACAUAGGAAACUAUGACAGCGGAAACGACAUCGAAAGAUGACUGAAGGAAGACGAAAGUCAGAACCUGUUCGCAGGUUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Chesterfield","uid":"337","picture":"sites\/default\/files\/pictures\/picture-337.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"16","au":"10","meltpoint":"97.00","energy":"-37.4","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAA Loopy #3","id":"3001930","created":"1370751189","body":"Mod of Loopy #2. More A-U.","sequence":"GGAAACCAGUAUAGAAAUGUACAGGUUGGAAACAAGAUAGAAAUGUCAACCAAGGAAGCCGAAAGGCAGCUGUCGUUCGCGGCAGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"nascarnut","uid":"28158","picture":"sites\/default\/files\/pictures\/picture-28158.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"3","gc":"15","au":"8","meltpoint":"97.00","energy":"-36.1","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAA Loopy #2","id":"3001922","created":"1370750980","body":"Mod of Loopy #1 with more A-U and U-G's in stacks. Still pretty clean. :)","sequence":"GGAAACCAGUAUGGAAACGUACAGGUUGGAAACAAGAUAGAAAUGUCAACCAAGGAAGCCGAAAGGCAGCUCUCGUUCGCGGGAGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"nascarnut","uid":"28158","picture":"sites\/default\/files\/pictures\/picture-28158.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"3","gc":"16","au":"7","meltpoint":"97.00","energy":"-38.7","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAA Loopy #1","id":"3001888","created":"1370750541","body":"No comment","sequence":"GGAAACCAGUCUCGAAAGAGACAGGCGGGAAACCAGAUCGAAAGAUCAGCCAAGGAAGCCGAAAGGCAGCUCUGGUUCGCCGGAGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"nascarnut","uid":"28158","picture":"sites\/default\/files\/pictures\/picture-28158.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"1","gc":"20","au":"5","meltpoint":"107.00","energy":"-49.6","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"try 1","id":"2995823","created":"1370694899","body":"No comment","sequence":"GGAAAGCAAUGCAGAAAUGCGUAGGCGCGAAAGCAGUACGAAAGUACAGCCAAGCAAGAGGAAACUCAGGUGACGUUCGCGUCACCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"yummy","uid":"101363","picture":"","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"1","gc":"18","au":"7","meltpoint":"97.00","energy":"-43.2","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"rna243243","id":"2992320","created":"1370643433","body":"234243","sequence":"GGAAAGGAGAGUAGAAAUACUCAGCGGCGAAAGCAGAGCGAAAGCUCACGCAACCAACUCGAAAGAGAAGUGAUCUUCGGAUCACUAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"davidpat","uid":"46802","picture":"sites\/default\/files\/pictures\/picture-46802.jpg","synthesis-score":"87","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"17","au":"9","meltpoint":"97.00","energy":"-43.6","has-fold-data":"0","SHAPE":"1, 0.3913, 0.2868, 0.7032, 1.1511, 0.4789, 0.4973, 0.8438, 0.8121, -0.0795, 0.0884, 0.0191, -0.094, 0.1321, 0.4378, 0.9504, 0.3867, 0.8012, 0.2327, 0.1688, -0.0267, 0.0843, 0.0153, 1.1721, 0.3294, 0.1643, 0.5706, 0.2032, 0.3236, 0.5637, 0.8512, 1.2781, 0.9834, 0.4513, 0.4912, 0.9323, 0.1117, 0.1486, 0.0371, 0.2221, 0.1601, 1.0316, 0.1735, 0.448, 0.1199, 0.0719, 0.0035, 0.1433, 0.2499, 0.287, 0.2125, 0.2939, 0.8603, 1.0516, 0.1141, 0.3406, 0.9081, 0.4678, 0.2331, 0.0998, -0.0016, 0.1327, 0.7841, 0.3848, 0.3347, 0.3972, 0.1319, 0.9083, 0.7705, 0.2998, 0.1857, 0.0928, 0.0618, 0.1978, 0.0307, 0.092, 0.4137, 0.0545, 0.1818, 0, 0","SHAPE-threshold":"0.372","SHAPE-max":"0.682","SHAPE-min":"0.062","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.062,\"max\":0.682,\"threshold\":0.372,\"peaks\":[0.3913,0.2868,0.7032,1.1511,0.4789,0.4973,0.8438,0.8121,-0.0795,0.0884,0.0191,-0.094,0.1321,0.4378,0.9504,0.3867,0.8012,0.2327,0.1688,-0.0267,0.0843,0.0153,1.1721,0.3294,0.1643,0.5706,0.2032,0.3236,0.5637,0.8512,1.2781,0.9834,0.4513,0.4912,0.9323,0.1117,0.1486,0.0371,0.2221,0.1601,1.0316,0.1735,0.448,0.1199,0.0719,0.0035,0.1433,0.2499,0.287,0.2125,0.2939,0.8603,1.0516,0.1141,0.3406,0.9081,0.4678,0.2331,0.0998,-0.0016,0.1327,0.7841,0.3848,0.3347,0.3972,0.1319,0.9083,0.7705,0.2998,0.1857,0.0928,0.0618,0.1978,0.0307,0.092,0.4137,0.0545,0.1818,0,0]}]"},{"title":"rna243","id":"2992309","created":"1370643387","body":"234","sequence":"GGAAAGGAGCGGCGAAAGCCGCAGCGGCGAAAGCAGGGCGAAAGCCCACGCAACCAACGCGAAAGCGAGGUGGUCUUCGGACCACCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"davidpat","uid":"46802","picture":"sites\/default\/files\/pictures\/picture-46802.jpg","synthesis-score":"83","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"24","au":"2","meltpoint":"107.00","energy":"-58.3","has-fold-data":"0","SHAPE":"1, 0.4074, 0.0393, 1.2303, 0.811, 0.1652, 0, 0.2678, 0.9253, 0, 0.1319, 0.1317, 0, 0, 0.2624, 0.1542, 0.1952, 0.7088, 0, 0, 0, 0, 0.3207, 1.1364, 0.4393, 0, 0.1253, 0.2497, 0.2488, 0.7388, 0.3675, 0.8475, 0.8376, 0.2385, 0.356, 0, 0, 0.2366, 0, -0.0007, 0, 0.5847, 0.4647, 0, 0.116, 0, 0, 0.1158, 0.8016, 0.4552, 0, 0.1514, 0.6005, 1.1451, 0.1106, 0.4399, 0.6538, 1.0735, 0.0849, 0.1067, 0.1066, 0.4237, 0.395, 1.1368, 0.7846, 0.2032, 0.2531, 0.3526, 0.5002, 0.1995, -0.2334, 0, 0.0654, 0.2968, 0, 0, 0.3936, 0.0983, 0.0981, 0, 0","SHAPE-threshold":"0.288","SHAPE-max":"0.528","SHAPE-min":"0.048","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.048,\"max\":0.528,\"threshold\":0.288,\"peaks\":[0.4074,0.0393,1.2303,0.811,0.1652,0,0.2678,0.9253,0,0.1319,0.1317,0,0,0.2624,0.1542,0.1952,0.7088,0,0,0,0,0.3207,1.1364,0.4393,0,0.1253,0.2497,0.2488,0.7388,0.3675,0.8475,0.8376,0.2385,0.356,0,0,0.2366,0,-0.0007,0,0.5847,0.4647,0,0.116,0,0,0.1158,0.8016,0.4552,0,0.1514,0.6005,1.1451,0.1106,0.4399,0.6538,1.0735,0.0849,0.1067,0.1066,0.4237,0.395,1.1368,0.7846,0.2032,0.2531,0.3526,0.5002,0.1995,-0.2334,0,0.0654,0.2968,0,0,0.3936,0.0983,0.0981,0,0]}]"},{"title":"balance","id":"2990441","created":"1370632202","body":"smooth stats","sequence":"GGAAAGCAGAUACGAAAGUGUCAGACCAGAAAUGAGUACGAAAGUACAGUCAAGCAAGUAGAAAUACACAGUUAGUUCGCUGAUUGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"machinelves","uid":"2577","picture":"sites\/default\/files\/pictures\/picture-2577.gif","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"3","gc":"12","au":"11","meltpoint":"87.00","energy":"-29.4","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"MAT - GAAA Loop D3","id":"2987579","created":"1370609564","body":"No comment","sequence":"GGAAAGCAGAUACGAAAGUAUCAGGCGCGAAAGCAGAUCGAAAGAUCAGCCAAGCAAGCGGAAACGCAGCAUGUGUUCGCACGUGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"mat747","uid":"267","picture":"sites\/default\/files\/pictures\/picture-267.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"1","gc":"18","au":"7","meltpoint":"97.00","energy":"-45","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"It's all about the tetras","id":"2969131","created":"1370471065","body":"No comment","sequence":"GGAAAGCAGCUAGGAAACUAGCAGCGGCGAAAGCAGCUCGAAAGAGCACGCAAGCAAGCCGAAAGGCAGAGCUGCUUCGGCAGCUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"starryjess","uid":"11775","picture":"sites\/default\/files\/pictures\/picture-11775.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"21","au":"5","meltpoint":"107.00","energy":"-54.4","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Default title","id":"2967794","created":"1370459590","body":"No comment","sequence":"GGAAAUCAGUAAGGAAACUUACAGACGGGAAACCAGAAGGAAACUUCAGUCAAGAAAGAUGAAAAUCAGUUGUGGUUCGCUACAGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Fullsail","uid":"55985","picture":"","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"2","gc":"13","au":"11","meltpoint":"97.00","energy":"-33.2","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAA Loop #2","id":"2963725","created":"1370434804","body":"A Minor Change From #1","sequence":"GGAAAGCAGUGAGGAAACUCACAGUGGCGAAAGCAGUGCGAAAGCACACACAAGCGAGACGAAAGUCACAACUUGUUCGCAAGUUGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"DPope","uid":"61888","picture":"sites\/default\/files\/pictures\/picture-61888.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"17","au":"9","meltpoint":"97.00","energy":"-42.1","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAA1","id":"2956793","created":"1370373891","body":"Dots are a little fuzzy, but I like the melting plot. But does that mean it might decide to go for something even lower free energy?","sequence":"GGAAAGCAGGUACGAAAGUGCCGCACGCGAAAGCAGAUCGAAAGAUCAGUGAAGCAAGUGGAAACACAGAGGACCUUCGGGUCCUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"macclark52","uid":"44631","picture":"sites\/default\/files\/pictures\/picture-44631.png","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"1","gc":"18","au":"7","meltpoint":"107.00","energy":"-48.2","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAA 3\/Eli mod","id":"2949730","created":"1370285918","body":"0.4 hairpins. Neck per Eli. Only flipped one GC pair (54-7) for slightly lower energy in the multiloop.","sequence":"GGAAAGCAGUAUCGAAAGAUACAGCCGCGAAAGCAGAUCGAAAGAUCAGGCAAGCAAGCCGAAAGGCAGGACUCGUUCGCGAGUCCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"wateronthemoon","uid":"57743","picture":"sites\/default\/files\/pictures\/picture-57743.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"19","au":"7","meltpoint":"97.00","energy":"-47.9","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAA 2","id":"2949384","created":"1370283998","body":"GCs stacked and doubled at loop bases and oriented for 0.2 energy. Will this reinforcement help hold loops together? Still great dot, flat 107 melt, etc.","sequence":"GGAAAGCAGUAGGGAAACCUACAGACGGGAAACCAGUGGGAAACCACAGUCAAGCAAGCCGAAAGGCAGGUCGCCUUCGGGCGACCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"wateronthemoon","uid":"57743","picture":"sites\/default\/files\/pictures\/picture-57743.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"21","au":"5","meltpoint":"107.00","energy":"-54.7","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Variation of my original GAAAH! Loop","id":"2936372","created":"1370138266","body":"Higher everything","sequence":"GGAAAGCGGUAUCGAAAGAUACAGGCGCGAAAGCAGUACGAAAGUACAGCCAAGCAAGUCGAAAGACAGCAUCACUUCGGUGAUGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"janetmason","uid":"56579","picture":"sites\/default\/files\/pictures\/picture-56579.png","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"17","au":"9","meltpoint":"97.00","energy":"-46.7","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Meechl GAAA loop","id":"2934974","created":"1370127225","body":"All GC loop closures in same orientation.","sequence":"GGAAAGCAAGUACGAAAGUACUAGUGGCGAAAGCAGUACGAAAGUACACACAAGCAAGUCGAAAGACAAGACUGCUUCGGCAGUCUAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Meechl","uid":"26574","picture":"sites\/default\/files\/pictures\/picture-26574.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"16","au":"10","meltpoint":"107.00","energy":"-43.1","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Omei's GAAA loop D3","id":"2920179","created":"1370045408","body":"After reviewing the frequency and observed 3D structure of naturally occuring GAAA loops, I am hypothesizing that GG(GAAA)CC, GG(GAAA)CU, CC(GAAA)GG and GC(GAAA)GC are particularly promising. My three designs for this lab involve different arrangements of these four.\r","sequence":"GGAAAGCAGAUCCGAAAGGAUCAGUCGCGAAAGCAAUGGGAAACCAUAGACAAGCAACGGGAAACUGAGUCAUAGUUCGCUAUGACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Omei","uid":"57675","picture":"sites\/default\/files\/pictures\/picture-57675.png","synthesis-score":"85","synthesis-round":"1","submitted-round":"1","gu":"1","gc":"16","au":"9","meltpoint":"97.00","energy":"-40.4","has-fold-data":"0","SHAPE":"1, -0.1649, 0.5121, 0.813, 0.992, 0.838, 0.1727, 0.296, 0.2976, -0.0278, 0.0495, 0.0742, 0.0247, 0.0494, 0.0337, 0.4515, 0.3491, 0.0688, 0.0486, 0.0443, 0.0969, 0.0583, 0.034, 0.9302, 1.3418, 0.334, 0.5313, 0.2148, 0.2555, 0.3037, 1.2385, 1.1318, 0.9966, 0.4333, 0.2736, 0.7663, 0.2547, 0.1168, 0.0211, 0.1055, 0.3046, 0.5142, 0.3733, 0.5711, 0.0719, -0.0323, 0.0672, 0.4364, 0.8307, 1.1698, 0.9816, 0.8258, 0.9132, 1.1385, 0.5012, 0.2958, 0.8946, 0.4896, 0.271, 0.1602, 0.3941, 0.4161, 1.8268, 0.7704, 0.5059, 0.1486, 0.2196, 0.2985, 0.5507, 0.7167, 0.2433, 0.0771, 0.0067, 0.2457, 0.2111, 0.2375, 0.93, 0.2385, 0.3204, 0, 0","SHAPE-threshold":"0.424","SHAPE-max":"0.778","SHAPE-min":"0.071","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.071,\"max\":0.778,\"threshold\":0.424,\"peaks\":[-0.1649,0.5121,0.813,0.992,0.838,0.1727,0.296,0.2976,-0.0278,0.0495,0.0742,0.0247,0.0494,0.0337,0.4515,0.3491,0.0688,0.0486,0.0443,0.0969,0.0583,0.034,0.9302,1.3418,0.334,0.5313,0.2148,0.2555,0.3037,1.2385,1.1318,0.9966,0.4333,0.2736,0.7663,0.2547,0.1168,0.0211,0.1055,0.3046,0.5142,0.3733,0.5711,0.0719,-0.0323,0.0672,0.4364,0.8307,1.1698,0.9816,0.8258,0.9132,1.1385,0.5012,0.2958,0.8946,0.4896,0.271,0.1602,0.3941,0.4161,1.8268,0.7704,0.5059,0.1486,0.2196,0.2985,0.5507,0.7167,0.2433,0.0771,0.0067,0.2457,0.2111,0.2375,0.93,0.2385,0.3204,0,0]}]"},{"title":"Omei's GAAA loop D2","id":"2920102","created":"1370045133","body":"After reviewing the frequency and observed 3D structure of naturally occuring GAAA loops, I am hypothesizing that GG(GAAA)CC, GG(GAAA)CU, CC(GAAA)GG and GC(GAAA)GC are particularly promising. My three designs for this lab involve different arrangements of these four.\r","sequence":"GGAAAGCAGAUGCGAAAGCAUCAGUCGGGAAACCAAUGGGAAACUAUAGACAAGCAAGCCGAAAGGCAGUCAAUGUUCGCAUUGACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Omei","uid":"57675","picture":"sites\/default\/files\/pictures\/picture-57675.png","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"1","gc":"16","au":"9","meltpoint":"97.00","energy":"-40.9","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Omei's GAAA loop D1","id":"2919993","created":"1370044821","body":"After reviewing the frequency and observed 3D structure of naturally occuring GAAA loops, I am hypothesizing that GG(GAAA)CC, GG(GAAA)CU, CC(GAAA)GG and GC(GAAA)GC are particularly promising. My three designs for this lab involve different arrangements of these four.","sequence":"GGAAAGCAGAUUCGAAAGGAUCAGUCCCGAAAGGAAUCCGAAAGGAUAGACAAGCAAGGCGAAAGCCAGUCUAUGUUCGCAUAGACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Omei","uid":"57675","picture":"sites\/default\/files\/pictures\/picture-57675.png","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"1","gc":"16","au":"9","meltpoint":"97.00","energy":"-40.2","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Attempt 3","id":"2918288","created":"1370039924","body":"7 GC -15.6 kcal","sequence":"GGAAAGCAUAUGAGAAAUUAUAAGACCAGAAAUGAGUGUGAAAAUACAGUCAAGCAACGUGAAAAUGACAAUAAGUUCGUUUAUUGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Malcolm","uid":"52361","picture":"sites\/default\/files\/pictures\/picture-52361.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"4","gc":"8","au":"14","meltpoint":"67.00","energy":"-15.6","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Attempt 2","id":"2918247","created":"1370039728","body":"11 GC -28.8 kcal","sequence":"GGAAAGCAUAUGGGAAACUAUAAGACCGGAAACGAGUGGGAAACUACAGUCAAGCAAGUGGAAACGCACUAUAAGUUCGUUUAUAGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Malcolm","uid":"52361","picture":"sites\/default\/files\/pictures\/picture-52361.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"4","gc":"12","au":"10","meltpoint":"87.00","energy":"-28.8","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Attempt 1","id":"2918209","created":"1370039608","body":"7 GC -17.2 kcal","sequence":"GGAAAGCAUAUAUGAAAAUAUAAGACCUGAAAAGAGUAUGAAAAUACAGUCAAGCAAGAUGAAAAUCAGAAUAAGUUCGUUUAUUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Malcolm","uid":"52361","picture":"sites\/default\/files\/pictures\/picture-52361.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"1","gc":"8","au":"17","meltpoint":"67.00","energy":"-17.2","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Eli's design Modified","id":"2912486","created":"1369967831","body":"I took the first design of Eli's and did a flip at nts 25\/50. The dot graph is a little 'tighter' with more white space.\rBarcode modified.","sequence":"GGAAACCAGUAUCGAAAGAUACAGGCGCGAAAGCAGAUCGAAAGAUCAGCCAAGGAAGCCGAAAGGCAGACGCACUUCGGUGCGUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"janelle","uid":"44066","picture":"sites\/default\/files\/pictures\/picture-44066.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"19","au":"7","meltpoint":"107.00","energy":"-50","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Jieux Modified","id":"2912444","created":"1369966960","body":"I flipped a GC for a better orientation.\rThe melt changed somewhat (not that I think that is better)\rhowever, roughly the same. The barcode was modified. ","sequence":"GGAAAGCAGUGACGAAAGUCACACAGGCGAAAGCAGUGCGAAAGCACACUGAAGCAAGACGAAAGUCAGCAGCACUUCGGUGCUGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"janelle","uid":"44066","picture":"sites\/default\/files\/pictures\/picture-44066.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"19","au":"7","meltpoint":"107.00","energy":"-49.5","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Whats up with this?","id":"2912185","created":"1369961880","body":"No comment","sequence":"GGAAACCACUCACGAAAGUGAGGACGCGGAAACGAGUAGGAAACUACACGUAAGGAAGUGGAAACACACACGAGCUUCGGCUCGUGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Matt Indykiewicz","uid":"79043","picture":"sites\/default\/files\/pictures\/picture-79043.gif","synthesis-score":"86","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"18","au":"8","meltpoint":"107.00","energy":"-43.4","has-fold-data":"0","SHAPE":"1, 0.1878, 0.2348, 1.0628, 0.6966, 0.2593, 0.0499, 0.0933, 0.3964, -0.0405, 0.0124, 0.1219, 0.0493, 0.0089, 0.0738, 0.8272, 0.3708, 0.4766, 0.116, 0.0395, 0.1032, 0.0955, 0.0392, 0.7838, 0.6985, 0.672, 0.516, 0.1335, 0.1842, 0.5754, 0.9559, 0.8303, 0.2198, 0.0257, 0.2189, 0.5891, 0.2379, 0.2478, 0.2327, 0.0715, 0.3842, 1.0979, 0.5628, 0.555, 0.0701, 0.1905, 0.0604, 0.1043, 0.0007, 0.1227, 0.1225, 0.4966, 0.8905, 0.4371, 0.3157, 0.6842, 0.7316, 0.7255, 0.358, 0.1139, 0.0741, 0.4708, 1.2036, 0.3654, 0.3542, 0.3672, 0.1663, 0.2769, 0.2002, 0.0469, 0.018, 0, 0.0898, 0.1575, -0.0252, 0.4405, 0.9377, 0.1225, 0.3828, 0, 0","SHAPE-threshold":"0.325","SHAPE-max":"0.595","SHAPE-min":"0.054","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.054,\"max\":0.595,\"threshold\":0.325,\"peaks\":[0.1878,0.2348,1.0628,0.6966,0.2593,0.0499,0.0933,0.3964,-0.0405,0.0124,0.1219,0.0493,0.0089,0.0738,0.8272,0.3708,0.4766,0.116,0.0395,0.1032,0.0955,0.0392,0.7838,0.6985,0.672,0.516,0.1335,0.1842,0.5754,0.9559,0.8303,0.2198,0.0257,0.2189,0.5891,0.2379,0.2478,0.2327,0.0715,0.3842,1.0979,0.5628,0.555,0.0701,0.1905,0.0604,0.1043,0.0007,0.1227,0.1225,0.4966,0.8905,0.4371,0.3157,0.6842,0.7316,0.7255,0.358,0.1139,0.0741,0.4708,1.2036,0.3654,0.3542,0.3672,0.1663,0.2769,0.2002,0.0469,0.018,0,0.0898,0.1575,-0.0252,0.4405,0.9377,0.1225,0.3828,0,0]}]"},{"title":"GAAAloopdesing2","id":"2909106","created":"1369877353","body":"No comment","sequence":"GGAAAGCACUUAGGAAACUGAGAGUCGCGAAAGCACUGCGAAAGUAGAGACAAGCAACUGGAAACAGACGGGCCGUUCGCGGCCCGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"cataway","uid":"57874","picture":"","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"2","gc":"19","au":"5","meltpoint":"107.00","energy":"-44.1","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAAloopdesing1","id":"2909096","created":"1369877180","body":"No comment","sequence":"GGAAAGCAUUUAGGAAACUAAAAGUCGCGAAAGCACUACGAAAGUAGAGACAAGCAACUGGAAACAGACCCGCGGUUCGCCGCGGGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"cataway","uid":"57874","picture":"","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"18","au":"8","meltpoint":"107.00","energy":"-42","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"limits","id":"2907191","created":"1369839516","body":"No comment","sequence":"GGAAACCAGAUACGAAAGUAUCAGUCGCGAAAGCAGUACGAAAGUACAGACUAGGAACAGGAAACUGACAGAUAUUUCGAUAUCUGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"armin","uid":"19442","picture":"","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"14","au":"12","meltpoint":"87.00","energy":"-35.1","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAA Loop #1","id":"2905640","created":"1369795293","body":"No comment","sequence":"GGAAAGCAGUGAGGAAACUCACAGUGGCGAAAGCAGUGGGAAACCACACACAAGCGAGACGAAAGUCACAACUAGUUCGCUAGUUGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"DPope","uid":"61888","picture":"sites\/default\/files\/pictures\/picture-61888.jpg","synthesis-score":"89","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"17","au":"9","meltpoint":"97.00","energy":"-42.6","has-fold-data":"0","SHAPE":"1, 1.0242, 0.8476, 1.0673, 0.6361, 0.641, 0.4134, 0.1506, 0.7206, 0.1359, 0.0848, 0.0509, 0.0409, 0.0846, 0.0985, 0.5818, 0.6754, 0.4123, 0.037, 0.0226, 0.115, -0.0207, 0.2102, 1.1947, 1.4475, 0.3089, 0.8817, 0.1829, 0.1122, 0.3086, 1.2827, 0.5366, 0.7618, 0.4211, 0.3408, 1.1278, 0.1452, -0.053, 0.0307, 0.0904, 0.2963, 0.7714, 0.9587, 0.3782, 0.1354, 0.04, 0.0099, 0.0576, 0.8891, 0.2164, 0.7735, 0.6755, 0.939, 1.2106, 0.2423, 0.1772, 0.5615, 0.6564, 0.2309, 0.2079, 0.2102, 0.2955, 0.6082, 0.3332, 0.5884, 0.2751, 0.2266, 0.2589, 0.1727, 0.0821, 0.1296, 0.0798, 0.0705, 0.1978, 0.1675, 0.1151, 0.5607, 0.0924, 0.2989, 0, 0","SHAPE-threshold":"0.376","SHAPE-max":"0.69","SHAPE-min":"0.063","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.063,\"max\":0.69,\"threshold\":0.376,\"peaks\":[1.0242,0.8476,1.0673,0.6361,0.641,0.4134,0.1506,0.7206,0.1359,0.0848,0.0509,0.0409,0.0846,0.0985,0.5818,0.6754,0.4123,0.037,0.0226,0.115,-0.0207,0.2102,1.1947,1.4475,0.3089,0.8817,0.1829,0.1122,0.3086,1.2827,0.5366,0.7618,0.4211,0.3408,1.1278,0.1452,-0.053,0.0307,0.0904,0.2963,0.7714,0.9587,0.3782,0.1354,0.04,0.0099,0.0576,0.8891,0.2164,0.7735,0.6755,0.939,1.2106,0.2423,0.1772,0.5615,0.6564,0.2309,0.2079,0.2102,0.2955,0.6082,0.3332,0.5884,0.2751,0.2266,0.2589,0.1727,0.0821,0.1296,0.0798,0.0705,0.1978,0.1675,0.1151,0.5607,0.0924,0.2989,0,0]}]"},{"title":"Fiskers GAAA loop D3","id":"2904971","created":"1369783482","body":"With neck from the topscorer in CL 5 - The none such. The rarest neck among the winners, the other had the opposite pattern. ","sequence":"GGAAAGGAGUAUCGAAAGAUACAGCCGCGAAAGCAGAUCGAAAGAUCAGGCAACCAAGCCGAAAGGCAGUACUCGUUCGCGAGUACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Eli Fisker","uid":"8627","picture":"sites\/default\/files\/pictures\/picture-8627.jpg","synthesis-score":"86","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"18","au":"8","meltpoint":"97.00","energy":"-45.3","has-fold-data":"0","SHAPE":"1, -0.0435, 0.4579, 0.9516, 0.5562, 0.0729, 0.145, 0.1174, 0.0401, -0.0317, -0.0902, -0.1171, -0.0585, 0.1618, 0.027, 0.4288, 0.2137, 0.0534, 0.08, -0.0318, 0.1861, 0.0531, 0.2735, 1.3747, 0.9162, 0.0596, 0.0268, 0.1643, 0.2089, 0.8849, 0.6826, 0.7338, 0.6695, 0.1046, 0.1992, 0.3822, 0.0477, -0.0436, 0.0238, 0.0952, 0.1087, 0.4603, 0.2001, 0.1069, 0.513, 0.1396, 0.0697, 0.1006, 0.3312, 0.4322, -0.0459, 0.1145, 0.8372, 0.5241, 0.209, 0.3196, 0.3418, 0.6454, 0.1835, 0, 0.0656, 0.0983, 0.7455, 0.3334, 0.0609, 0.0715, 0.1817, -0.0536, 0.3252, 0.0268, 0.211, 0.0696, 0.0904, 0.2095, 0.1464, 0.2406, 0.578, 0.1134, 0.5623, 0, 0","SHAPE-threshold":"0.246","SHAPE-max":"0.451","SHAPE-min":"0.041","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.041,\"max\":0.451,\"threshold\":0.246,\"peaks\":[-0.0435,0.4579,0.9516,0.5562,0.0729,0.145,0.1174,0.0401,-0.0317,-0.0902,-0.1171,-0.0585,0.1618,0.027,0.4288,0.2137,0.0534,0.08,-0.0318,0.1861,0.0531,0.2735,1.3747,0.9162,0.0596,0.0268,0.1643,0.2089,0.8849,0.6826,0.7338,0.6695,0.1046,0.1992,0.3822,0.0477,-0.0436,0.0238,0.0952,0.1087,0.4603,0.2001,0.1069,0.513,0.1396,0.0697,0.1006,0.3312,0.4322,-0.0459,0.1145,0.8372,0.5241,0.209,0.3196,0.3418,0.6454,0.1835,0,0.0656,0.0983,0.7455,0.3334,0.0609,0.0715,0.1817,-0.0536,0.3252,0.0268,0.211,0.0696,0.0904,0.2095,0.1464,0.2406,0.578,0.1134,0.5623,0,0]}]"},{"title":"Perfectly balanced","id":"2904304","created":"1369765230","body":"Its a beautiful thing","sequence":"GGAAACCACACUCGAAAGAGUGGAGGGCGAAAGCAGUGUGAAAACACACCUAAGGGAUGUGAAAACAAACAGUGAUUCGUCACUGUAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Matt Indykiewicz","uid":"79043","picture":"sites\/default\/files\/pictures\/picture-79043.gif","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"15","au":"11","meltpoint":"97.00","energy":"-33.79","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAA + GUs","id":"2903748","created":"1369743901","body":"It would be interesting to see if closing the GAAA loop with GUs works well in the lab","sequence":"GGAAAGCGCGUGGGAAAUCACGAGCCGAGAAAUCACUCGGAAACGAGAGGCUAGCGAGUUGAAAGACACAUACGCUUCGGCGUAUGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"jruaya","uid":"47022","picture":"","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"2","gc":"17","au":"7","meltpoint":"97.00","energy":"-35.29","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Which will hold and which will fall apart?","id":"2902540","created":"1369703811","body":"A variety of solutions in one design. GCs and 0.2 in the short stacks. More risk in the longer: an AU and a GU with supporting GCs.","sequence":"GGAAAGCAGUAGAGAAAUCUACAGACGGGAAACCAGUGUGAAAGCACAGUCAAGCAAGCGGAAACGCAGGUCCGCUUCGGCGGACCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"wateronthemoon","uid":"57743","picture":"sites\/default\/files\/pictures\/picture-57743.jpg","synthesis-score":"91","synthesis-round":"1","submitted-round":"1","gu":"1","gc":"19","au":"6","meltpoint":"107.00","energy":"-47.4","has-fold-data":"0","SHAPE":"1, 0.1518, 0.8646, 0.7132, 0.9146, 0.5816, 0.1605, 0.3777, 0.3825, 0.1198, 0.1196, 0.0631, 0, 0.2115, 0.2076, 0.908, 0.4222, 0.5644, 0.0865, 0.0576, 0.0302, 0.1149, 0.1577, 0.5688, 0.8987, 0.2233, 0.1256, 0.278, 0.3412, 0.7445, 0.953, 0.8529, 0.7609, 0.1578, 0.3402, 0.9129, 0.1286, 0.1024, 0.3577, 0.3053, 0.3796, 0.8872, 0.3296, 0.6731, 0.3965, 0.1025, 0.1707, 0.28, 0.7793, 0.6245, 0.1959, 0.2775, 0.8474, 1.0421, 1.0365, 0.4478, 1.0155, 0.9891, 0.3895, 0.108, 0.3226, 0.1502, 0.7225, 0.7329, 0.449, 0.1667, 0.3318, 0.3166, 0.5658, 0.2109, 0.0061, 0.0611, -0.0347, 0.1134, 0.0811, 0.0608, 0.5431, 0.2106, 0.1701, 0, 0","SHAPE-threshold":"0.389","SHAPE-max":"0.714","SHAPE-min":"0.065","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.065,\"max\":0.714,\"threshold\":0.389,\"peaks\":[0.1518,0.8646,0.7132,0.9146,0.5816,0.1605,0.3777,0.3825,0.1198,0.1196,0.0631,0,0.2115,0.2076,0.908,0.4222,0.5644,0.0865,0.0576,0.0302,0.1149,0.1577,0.5688,0.8987,0.2233,0.1256,0.278,0.3412,0.7445,0.953,0.8529,0.7609,0.1578,0.3402,0.9129,0.1286,0.1024,0.3577,0.3053,0.3796,0.8872,0.3296,0.6731,0.3965,0.1025,0.1707,0.28,0.7793,0.6245,0.1959,0.2775,0.8474,1.0421,1.0365,0.4478,1.0155,0.9891,0.3895,0.108,0.3226,0.1502,0.7225,0.7329,0.449,0.1667,0.3318,0.3166,0.5658,0.2109,0.0061,0.0611,-0.0347,0.1134,0.0811,0.0608,0.5431,0.2106,0.1701,0,0]}]"},{"title":"GAAAC","id":"2899590","created":"1369631053","body":"No comment","sequence":"GGAAACCAGAUGCGAAAGCAUCACGCCCGAAAGGACUAGGAAACUAGAGCGAAGGAAGACGAAAGUCACGUGCUGUUCGCAGUACGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"rnjensen45","uid":"60391","picture":"sites\/default\/files\/pictures\/picture-60391.jpg","synthesis-score":"86","synthesis-round":"1","submitted-round":"1","gu":"1","gc":"18","au":"7","meltpoint":"97.00","energy":"-41.3","has-fold-data":"0","SHAPE":"1, 0.369, 0.3915, 0.7137, 0.614, 0.5052, 0.1506, 0.3046, 0.4919, 0.1962, 0.07, -0.0137, 0.0118, 0.0165, 0.0548, 0.7793, 0.2829, 0.2748, -0.0211, 0.0405, 0.0956, 0.0319, 0.0506, 0.248, 0.3914, 0.2555, 0.2946, 0.0462, 0.226, 0.4793, 1.1492, 0.8202, 0.2145, 0.3245, 0.6781, 0.6952, 0.0712, 0.234, 0.1116, 0.1649, 0.2258, 0.6503, 0.5639, 0.4489, 0.1561, 0.2732, 0.1905, 0.381, 1.5082, 0.6179, 0.2362, 0.7848, 1.0614, 0.527, 0.3311, 0.8402, 0.9131, 0.8374, 0.3695, 0.1175, 0.1467, 0.266, 0.888, 0.4889, 0.8056, 0.3005, 0.1597, 0.1091, 0.2774, 0.1388, 0.0985, 0.089, 0.0484, 0.1183, 0.1083, 0.4743, 0.7658, 0.1254, 0.3266, 0, 0","SHAPE-threshold":"0.359","SHAPE-max":"0.657","SHAPE-min":"0.06","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.06,\"max\":0.657,\"threshold\":0.359,\"peaks\":[0.369,0.3915,0.7137,0.614,0.5052,0.1506,0.3046,0.4919,0.1962,0.07,-0.0137,0.0118,0.0165,0.0548,0.7793,0.2829,0.2748,-0.0211,0.0405,0.0956,0.0319,0.0506,0.248,0.3914,0.2555,0.2946,0.0462,0.226,0.4793,1.1492,0.8202,0.2145,0.3245,0.6781,0.6952,0.0712,0.234,0.1116,0.1649,0.2258,0.6503,0.5639,0.4489,0.1561,0.2732,0.1905,0.381,1.5082,0.6179,0.2362,0.7848,1.0614,0.527,0.3311,0.8402,0.9131,0.8374,0.3695,0.1175,0.1467,0.266,0.888,0.4889,0.8056,0.3005,0.1597,0.1091,0.2774,0.1388,0.0985,0.089,0.0484,0.1183,0.1083,0.4743,0.7658,0.1254,0.3266,0,0]}]"},{"title":"variations","id":"2898988","created":"1369625084","body":"Trying various closures","sequence":"GGAAAGCAGUAUCGAAAGAUACACUCGCGAAAGCACUAGGAAACUAGAGAGAAGCAAGACGAAAGUCAGAGAUUCUUCGGAAUCUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"jandersonlee","uid":"32627","picture":"sites\/default\/files\/pictures\/picture-32627.gif","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"15","au":"11","meltpoint":"97.00","energy":"-41.3","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Tesla's 3","id":"2898590","created":"1369622526","body":"Will the loops hold when the closing pair is AU or GU, but the next pair is GC?","sequence":"GGAAAGCAGGACAGAAAUGUCCAGCCGUGAAAACAGUGGGAAAUCACAGGCAAGCAAGCUGAAAGGCAGCUCCUCUUCGGAGGAGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Tesla'sDisciple","uid":"50065","picture":"sites\/default\/files\/pictures\/picture-50065.jpg","synthesis-score":"87","synthesis-round":"1","submitted-round":"1","gu":"2","gc":"18","au":"6","meltpoint":"107.00","energy":"-40.79","has-fold-data":"0","SHAPE":"1, 0.307, 0.8291, 1.1397, 0.7345, 0.5297, 0.1109, -0.0055, 0.1675, 0.0202, 0.0238, 0.1468, -0.0627, 0.0602, 0.1562, 0.5791, 0.4138, 0.6453, 0.0077, -0.0139, 0.0355, 0.1596, 0.0922, 0.6837, 0.105, -0.0494, 0.035, 0.1353, 0.0306, 0.2975, 0.2075, 0.722, 0.9556, 0.5811, 0.2448, 1.2417, 1.3587, 0.349, 0.5058, 0.5534, 0.9988, 1.1037, 0.8123, 0.6051, 0.1779, 0.0818, 0, 0.0934, 0.4152, 0.3353, 0.1164, 0.1833, 1.0052, 0.9218, 0.5048, 0.713, 0.6915, 0.9331, 0.4619, 0.1206, 0.6378, 0.2648, 0.6559, 0.9095, 0.4374, 0.3611, 0.3564, 0.2537, 0.1771, 0.0506, -0.0482, 0.101, 0.0505, 0.128, 0, 0.3772, 0.7919, 0.2722, 0.27, 0, 0","SHAPE-threshold":"0.372","SHAPE-max":"0.682","SHAPE-min":"0.062","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.062,\"max\":0.682,\"threshold\":0.372,\"peaks\":[0.307,0.8291,1.1397,0.7345,0.5297,0.1109,-0.0055,0.1675,0.0202,0.0238,0.1468,-0.0627,0.0602,0.1562,0.5791,0.4138,0.6453,0.0077,-0.0139,0.0355,0.1596,0.0922,0.6837,0.105,-0.0494,0.035,0.1353,0.0306,0.2975,0.2075,0.722,0.9556,0.5811,0.2448,1.2417,1.3587,0.349,0.5058,0.5534,0.9988,1.1037,0.8123,0.6051,0.1779,0.0818,0,0.0934,0.4152,0.3353,0.1164,0.1833,1.0052,0.9218,0.5048,0.713,0.6915,0.9331,0.4619,0.1206,0.6378,0.2648,0.6559,0.9095,0.4374,0.3611,0.3564,0.2537,0.1771,0.0506,-0.0482,0.101,0.0505,0.128,0,0.3772,0.7919,0.2722,0.27,0,0]}]"},{"title":"Tesla's 2","id":"2898532","created":"1369622244","body":"GU closing pair has terrible energy when faced the wrong way, but model says it's still stable. Let's see","sequence":"GGAAAGCAUACACGAAAGUGUAAGCCGAGAAAUCAGCUGGAAAUAGCAGGCAAGCAAGAUGAAAGUCAGAAGCACUUCGGUGCUUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Tesla'sDisciple","uid":"50065","picture":"sites\/default\/files\/pictures\/picture-50065.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"2","gc":"15","au":"9","meltpoint":"97.00","energy":"-36.1","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Tesla's 1","id":"2898499","created":"1369622074","body":"No comment","sequence":"GGAAAGCAUACAAGAAAUUGUAAGCCGCGAAAGCAAUAUGAAAAUAUAGGCAAGCAAGAGGAAACUCAGAUCAACUUCGGUUGAUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Tesla'sDisciple","uid":"50065","picture":"sites\/default\/files\/pictures\/picture-50065.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"13","au":"13","meltpoint":"97.00","energy":"-34.6","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Fiskers GAAA loop D2","id":"2897775","created":"1369613550","body":"Changed the neck","sequence":"GGAAAGCAGUAUCGAAAGAUACAGCCGCGAAAGCAGAUCGAAAGAUCAGGCAAGCAAGCCGAAAGGCAGUCAUCGUUCGCGAUGACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Eli Fisker","uid":"8627","picture":"sites\/default\/files\/pictures\/picture-8627.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"18","au":"8","meltpoint":"97.00","energy":"-45.7","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Fiskers GAAA loop D1","id":"2897727","created":"1369612801","body":"With neck inspiration from most of the winners in cloud lab 5 - the none such. ","sequence":"GGAAACCAGUAUCGAAAGAUACAGCCGCGAAAGCAGAUCGAAAGAUCAGGCAAGGAAGCCGAAAGGCAGUCUGUCUUCGGACAGACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Eli Fisker","uid":"8627","picture":"sites\/default\/files\/pictures\/picture-8627.jpg","synthesis-score":"87","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"18","au":"8","meltpoint":"97.00","energy":"-48.7","has-fold-data":"0","SHAPE":"1, 0.0815, 0.3939, 0.9961, 0.8289, 0.5762, 0.4513, 0.3825, 0.8162, 0.1854, 0.147, -0.0647, 0.0326, 0.0814, 0.1202, 0.3935, 0.164, 0.2407, 0.0481, 0.0481, 0.0245, 0.016, 0.0535, 0.4201, 0.2709, 0.0473, 0.1307, 0.264, 0.364, 0.7808, 1.224, 0.5971, 0.869, 0.4203, 0.5126, 0.58, 0.1158, -0.0577, 0.0577, 0.0504, 0.163, 0.2984, 0.2328, 0.1649, 0.6292, 0.2192, 0.0738, 0.1263, 0.2098, 0.486, 0.1696, 0.1715, 0.7709, 0.3743, 0.3093, 0.7736, 0.7386, 1.0272, 0.244, 0.0463, 0.1811, 0.2419, 0.5499, 0.4506, 0.3377, 0.2608, 0.1005, 0.0306, 0.3956, 0.1991, 0.1337, 0.0993, 0.0744, -0.0794, 0.0493, 0.152, 1.0247, 0.1811, 0.2753, 0, 0","SHAPE-threshold":"0.303","SHAPE-max":"0.556","SHAPE-min":"0.051","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.051,\"max\":0.556,\"threshold\":0.303,\"peaks\":[0.0815,0.3939,0.9961,0.8289,0.5762,0.4513,0.3825,0.8162,0.1854,0.147,-0.0647,0.0326,0.0814,0.1202,0.3935,0.164,0.2407,0.0481,0.0481,0.0245,0.016,0.0535,0.4201,0.2709,0.0473,0.1307,0.264,0.364,0.7808,1.224,0.5971,0.869,0.4203,0.5126,0.58,0.1158,-0.0577,0.0577,0.0504,0.163,0.2984,0.2328,0.1649,0.6292,0.2192,0.0738,0.1263,0.2098,0.486,0.1696,0.1715,0.7709,0.3743,0.3093,0.7736,0.7386,1.0272,0.244,0.0463,0.1811,0.2419,0.5499,0.4506,0.3377,0.2608,0.1005,0.0306,0.3956,0.1991,0.1337,0.0993,0.0744,-0.0794,0.0493,0.152,1.0247,0.1811,0.2753,0,0]}]"},{"title":"G at 8 Again","id":"2896390","created":"1369599852","body":"This time to improve the RNAshapes score of Hyphema's design, Mod of Ruler","sequence":"GGAAAGCGGAGACGAAAGUCUCAGCCGGGAAACCAGCACGAAAGUGCAGGCAAGCAAGAGGAAACUCAGGUUCACUUCGGUGAACCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Dennis9600","uid":"40516","picture":"sites\/default\/files\/pictures\/picture-40516.png","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"19","au":"7","meltpoint":"107.00","energy":"-50.8","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"G at 8","id":"2896329","created":"1369598869","body":"Mod of Zanna's design to boost the RNAshapes score.","sequence":"GGAAAGCGGUAGGGAAACCUACAGGCCGGAAACGAGCUGGAAACAGCAGCCAAGCAAGAGGAAACUCAGACUUCCUUCGGGAAGUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Dennis9600","uid":"40516","picture":"sites\/default\/files\/pictures\/picture-40516.png","synthesis-score":"85","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"19","au":"7","meltpoint":"107.00","energy":"-49.6","has-fold-data":"0","SHAPE":"1, 0.5135, 0.5931, 0.8159, 0.405, 0.2481, 0.062, 0.0309, 0.3385, 0.0922, 0.1533, 0.0307, 0, 0.0766, 0.2137, 0.3192, 0.3328, 0.2412, 0.1204, -0.0015, 0.1201, 0.0284, 0.1198, 0.209, 0.7094, 0.1475, 0.0589, 0.0589, 0.1147, 0.6004, 1.3768, 1.1627, 0.4336, 0.1605, 0.7135, 0.6319, 0.1627, 0.0607, 0.0271, -0.0069, 0.4821, 0.8891, 0.852, 0.6825, 0.5304, 0.3581, 0.2549, -0.0099, 0.3044, 0.5037, 0.1633, 0.1272, 0.4371, 0.6902, 0.6472, 0.5445, 0.8372, 0.6401, 0.7919, 0.5344, 0.3238, 0.2765, 0.7585, 0.571, 0.4554, 0.1927, 0.1337, 0.2553, 0.4358, 0.1158, 0.022, 0.0439, -0.1142, 0.0877, 0.0438, 0.0057, 0.3919, 0.0435, 0.2003, 0, 0","SHAPE-threshold":"0.321","SHAPE-max":"0.589","SHAPE-min":"0.054","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.054,\"max\":0.589,\"threshold\":0.321,\"peaks\":[0.5135,0.5931,0.8159,0.405,0.2481,0.062,0.0309,0.3385,0.0922,0.1533,0.0307,0,0.0766,0.2137,0.3192,0.3328,0.2412,0.1204,-0.0015,0.1201,0.0284,0.1198,0.209,0.7094,0.1475,0.0589,0.0589,0.1147,0.6004,1.3768,1.1627,0.4336,0.1605,0.7135,0.6319,0.1627,0.0607,0.0271,-0.0069,0.4821,0.8891,0.852,0.6825,0.5304,0.3581,0.2549,-0.0099,0.3044,0.5037,0.1633,0.1272,0.4371,0.6902,0.6472,0.5445,0.8372,0.6401,0.7919,0.5344,0.3238,0.2765,0.7585,0.571,0.4554,0.1927,0.1337,0.2553,0.4358,0.1158,0.022,0.0439,-0.1142,0.0877,0.0438,0.0057,0.3919,0.0435,0.2003,0,0]}]"},{"title":"Eh","id":"2894509","created":"1369572262","body":"No comment","sequence":"GGAAAUCAGAGCGGAAACGCUCACACCGGAAACGAUCCAGAAAUGGAAGUGAAGAGAUGGGAAACCAACAUAGCGUUCGCGCUAUGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"RedSpah","uid":"55082","picture":"sites\/default\/files\/pictures\/picture-55082.gif","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"17","au":"9","meltpoint":"107.00","energy":"-37.7","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Za","id":"2894507","created":"1369572228","body":"No comment","sequence":"GGAAACCAUCGAAGAAAUUCGAAGCUCAGAAAUGAACCCGAAAGGGUAAGCAAGGGACUCGAAAGAGACUGGUCGUUCGCGAUCAGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"RedSpah","uid":"55082","picture":"sites\/default\/files\/pictures\/picture-55082.gif","synthesis-score":"81","synthesis-round":"1","submitted-round":"1","gu":"1","gc":"16","au":"9","meltpoint":"97.00","energy":"-35","has-fold-data":"0","SHAPE":"1, 0.3811, 0.4176, 0.947, 0.7302, 0.2654, 0.0803, 0.3922, 0.8374, 0.1973, 0.1654, 0.2201, 0.4038, 0.2245, 0.2867, 0.8818, 0.6246, 0.732, 0.1576, 0.0296, 0.0296, 0.1183, 0.4761, 0.8537, 0.2432, 0.3763, 0.4247, 0.5987, 0.6453, 1.4809, 1.3919, 1.1574, 1.0457, 0.4019, 1.0175, 1.3117, 0.5271, -0.0096, 0.0186, 0.0783, 0.1422, 0.3421, 0.1553, 0.1082, 0.0529, 0.0752, 0.0285, 0.4449, 0.85, 1.1869, 0.6048, 0.4021, 0.9649, 0.4721, 0.0791, 0.214, 0.5514, 0.5795, 0.2461, 0.0661, 0.0327, 0.1857, 0.736, 0.493, 0.2984, 0.2551, 0.1542, 0.7074, 0.6774, 0.0561, 0.0364, 0.0248, 0.0675, 0.1323, 0.054, 0.2291, 0.8646, 0.0783, 0.5002, 0, 0","SHAPE-threshold":"0.417","SHAPE-max":"0.764","SHAPE-min":"0.069","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.069,\"max\":0.764,\"threshold\":0.417,\"peaks\":[0.3811,0.4176,0.947,0.7302,0.2654,0.0803,0.3922,0.8374,0.1973,0.1654,0.2201,0.4038,0.2245,0.2867,0.8818,0.6246,0.732,0.1576,0.0296,0.0296,0.1183,0.4761,0.8537,0.2432,0.3763,0.4247,0.5987,0.6453,1.4809,1.3919,1.1574,1.0457,0.4019,1.0175,1.3117,0.5271,-0.0096,0.0186,0.0783,0.1422,0.3421,0.1553,0.1082,0.0529,0.0752,0.0285,0.4449,0.85,1.1869,0.6048,0.4021,0.9649,0.4721,0.0791,0.214,0.5514,0.5795,0.2461,0.0661,0.0327,0.1857,0.736,0.493,0.2984,0.2551,0.1542,0.7074,0.6774,0.0561,0.0364,0.0248,0.0675,0.1323,0.054,0.2291,0.8646,0.0783,0.5002,0,0]}]"},{"title":"Ech","id":"2894502","created":"1369572190","body":"No comment","sequence":"GGAAAGCAUACGAGAAAUCGUAACCGGUGAAAACAAUGCGAAAGCAUACGGAAGCGACUGGAAACAGACCGGCCGUUCGCGGCCGGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"RedSpah","uid":"55082","picture":"sites\/default\/files\/pictures\/picture-55082.gif","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"19","au":"7","meltpoint":"107.00","energy":"-39.9","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Let the GAAAs begin.","id":"2892368","created":"1369525382","body":"Fairly clean dot-plot.","sequence":"GGAAACCAUAUACGAAAGUAUAACACCCGAAAGGACUAGGAAACUAGAGUGAAGGAAGAGGAAACUCACGUGUGGUUCGCCAUACGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"xenosapien","uid":"83579","picture":"","synthesis-score":"82","synthesis-round":"1","submitted-round":"1","gu":"1","gc":"15","au":"10","meltpoint":"97.00","energy":"-35.5","has-fold-data":"0","SHAPE":"1, 0.8918, 0.3602, 0.6883, 0.7644, 0.6138, 0.1741, 0.252, 1.1486, 0.2813, 0.192, 0.0235, 0.1345, 0.0583, 0.0758, 0.5495, 0.3108, 0.4626, 0.1135, 0.0978, 0.2472, 0.3131, 0.7395, 0.6395, 0.4898, 0.5468, 0.3885, 0.088, 0.2363, 0.5037, 0.8966, 0.6481, 0.1559, 0.4218, 0.6308, 0.7918, 0.1867, 0.3469, 0.1456, 0.13, 0.2814, 0.5621, 0.4106, 0.4732, 0.025, 0.263, 0.2016, 0.3221, 1.0044, 0.9487, 0.5075, 0.9705, 1.1266, 0.4374, 0.3018, 0.8367, 0.9967, 0.6322, 1.0586, 0.5839, 0.3646, 0.3702, 1.1126, 0.8303, 0.4559, 0.1198, 0.1297, 0.144, 0.1554, 0.1471, 0.0368, 0.0472, -0.0142, 0.0628, 0.0157, 0.1942, 0.6828, 0.1467, 0.4206, 0, 0","SHAPE-threshold":"0.411","SHAPE-max":"0.754","SHAPE-min":"0.069","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.069,\"max\":0.754,\"threshold\":0.411,\"peaks\":[0.8918,0.3602,0.6883,0.7644,0.6138,0.1741,0.252,1.1486,0.2813,0.192,0.0235,0.1345,0.0583,0.0758,0.5495,0.3108,0.4626,0.1135,0.0978,0.2472,0.3131,0.7395,0.6395,0.4898,0.5468,0.3885,0.088,0.2363,0.5037,0.8966,0.6481,0.1559,0.4218,0.6308,0.7918,0.1867,0.3469,0.1456,0.13,0.2814,0.5621,0.4106,0.4732,0.025,0.263,0.2016,0.3221,1.0044,0.9487,0.5075,0.9705,1.1266,0.4374,0.3018,0.8367,0.9967,0.6322,1.0586,0.5839,0.3646,0.3702,1.1126,0.8303,0.4559,0.1198,0.1297,0.144,0.1554,0.1471,0.0368,0.0472,-0.0142,0.0628,0.0157,0.1942,0.6828,0.1467,0.4206,0,0]}]"},{"title":"Mat - GAAP loop - D2","id":"2890959","created":"1369493740","body":"No comment","sequence":"GGAAAGCAGAUACGAAAGUAUCAGACGCGAAAGCAGAUCGAAAGAUCAGUCAAGCAAGCGGAAACGCAGCAUGUGUUCGCACAUGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"mat747","uid":"267","picture":"sites\/default\/files\/pictures\/picture-267.jpg","synthesis-score":"85","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"17","au":"9","meltpoint":"97.00","energy":"-43.3","has-fold-data":"0","SHAPE":"1, 0.4194, 0.9277, 1.3848, 0.53, 0.6068, 0.318, 0.2566, 0.4125, 0.0192, 0.0958, 0.0339, -0.0309, -0.0117, 0.0647, 0.606, 0.3152, 0.3692, 0.0748, 0.0066, 0.044, 0.1184, 0.143, 0.4401, 1.1736, 0.5885, 0.5325, 0.1247, 0.0495, 0.552, 1.3207, 0.8084, 0.721, 0.2057, 0.3471, 0.3757, 0.1, 0.061, -0.0138, 0.0499, 0.1574, 0.472, 0.2897, 0.2234, 1.0061, 0.0875, 0.0178, 0.1844, 0.8261, 1.2151, 1.042, 0.6872, 0.9385, 0.9381, 0.4373, 0.432, 0.9197, 1.1709, 0.2933, -0.0302, 0.2082, 0.2492, 1.1076, 0.9725, 0.4376, 0.2513, 0.1871, 0.2562, 0.4488, 0.1056, 0.0659, -0.0037, 0.0453, 0.2207, 0.1569, 0.4612, 1.0747, 0.2926, 0.3797, 0, 0","SHAPE-threshold":"0.395","SHAPE-max":"0.723","SHAPE-min":"0.066","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.066,\"max\":0.723,\"threshold\":0.395,\"peaks\":[0.4194,0.9277,1.3848,0.53,0.6068,0.318,0.2566,0.4125,0.0192,0.0958,0.0339,-0.0309,-0.0117,0.0647,0.606,0.3152,0.3692,0.0748,0.0066,0.044,0.1184,0.143,0.4401,1.1736,0.5885,0.5325,0.1247,0.0495,0.552,1.3207,0.8084,0.721,0.2057,0.3471,0.3757,0.1,0.061,-0.0138,0.0499,0.1574,0.472,0.2897,0.2234,1.0061,0.0875,0.0178,0.1844,0.8261,1.2151,1.042,0.6872,0.9385,0.9381,0.4373,0.432,0.9197,1.1709,0.2933,-0.0302,0.2082,0.2492,1.1076,0.9725,0.4376,0.2513,0.1871,0.2562,0.4488,0.1056,0.0659,-0.0037,0.0453,0.2207,0.1569,0.4612,1.0747,0.2926,0.3797,0,0]}]"},{"title":"Mat - GAAP loop","id":"2890942","created":"1369493570","body":"No comment","sequence":"GGAAAGCAGAUACGAAAGUAUCAGGCGCGAAAGCAGAUCGAAAGAUCAGCCAAGCAAGAGGAAACUCAGCUAACGUUCGCGUUAGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"mat747","uid":"267","picture":"sites\/default\/files\/pictures\/picture-267.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"17","au":"9","meltpoint":"97.00","energy":"-43.4","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"I'll Take One Of Each","id":"2890830","created":"1369491358","body":"In the spirit of experimentation, here is a different closure for each of the tetraloops.","sequence":"GGAAAGCAGGAUAGAAAUAUCCAGGCGCGAAAGCAGUAUGAAAAUACAGCCAAGCAAGAGGAAACUCAGCUGUUCUUCGGAACAGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Dennis9600","uid":"40516","picture":"sites\/default\/files\/pictures\/picture-40516.png","synthesis-score":"86","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"16","au":"10","meltpoint":"97.00","energy":"-42.2","has-fold-data":"0","SHAPE":"1, 0.793, 0.7663, 0.9513, 1.0759, 0.6506, -0.0532, 0.1925, 0.1246, 0.074, -0.1204, 0.1006, 0.067, 0.1337, 0.2332, 0.6275, 0.3615, 0.5911, 0.1324, 0.0673, 0.0324, 0.0972, 0.0647, 0.1936, 1.0808, 0.1586, 0.1298, 0.1263, 0.1418, 0.0815, 0.9314, 0.4321, 0.2473, 0.1546, 0.2291, 0.6507, 0.0912, -0.051, 0.2978, 0.2964, 0.366, 0.7906, 0.5441, 0.619, 0.4733, 0.2262, 0.2562, 0, 0.3682, 0.254, 0.0846, 0.2388, 0.0913, 0.5793, 0.3866, 0.3572, 0.8898, 0.7779, 0.7628, 0.3956, 0.3151, 0.3007, 0.9674, 0.7569, 0.1359, 0.3037, 0.1931, 0.2763, 0.3407, 0.1993, 0.174, 0.0993, 0.0496, 0.0154, 0.0248, 0.3205, 0.7563, 0.1461, 0.3151, 0, 0","SHAPE-threshold":"0.31","SHAPE-max":"0.568","SHAPE-min":"0.052","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.052,\"max\":0.568,\"threshold\":0.31,\"peaks\":[0.793,0.7663,0.9513,1.0759,0.6506,-0.0532,0.1925,0.1246,0.074,-0.1204,0.1006,0.067,0.1337,0.2332,0.6275,0.3615,0.5911,0.1324,0.0673,0.0324,0.0972,0.0647,0.1936,1.0808,0.1586,0.1298,0.1263,0.1418,0.0815,0.9314,0.4321,0.2473,0.1546,0.2291,0.6507,0.0912,-0.051,0.2978,0.2964,0.366,0.7906,0.5441,0.619,0.4733,0.2262,0.2562,0,0.3682,0.254,0.0846,0.2388,0.0913,0.5793,0.3866,0.3572,0.8898,0.7779,0.7628,0.3956,0.3151,0.3007,0.9674,0.7569,0.1359,0.3037,0.1931,0.2763,0.3407,0.1993,0.174,0.0993,0.0496,0.0154,0.0248,0.3205,0.7563,0.1461,0.3151,0,0]}]"},{"title":"GU\/CG Quads on 0.4 loops","id":"2889944","created":"1369448344","body":"kept optimal stack energy throughout with extra GC on other side of GU. Would be interesting test on the quad energy of this versus the use of an AU","sequence":"GGAAAGCAGUGGCGAAAGUCACAGCGGCGAAAGCAGGGCGAAAGUCCACGCAAGCAAGCCGAAAGGCAGUGCUACUUCGGUAGUACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Hyphema","uid":"58224","picture":"sites\/default\/files\/pictures\/picture-58224.jpg","synthesis-score":"86","synthesis-round":"1","submitted-round":"1","gu":"3","gc":"19","au":"4","meltpoint":"97.00","energy":"-48.8","has-fold-data":"0","SHAPE":"1, 0.3432, 0.9035, 0.8572, 0.5425, 0.6674, 0.2706, 0.2147, 0.6767, 0.127, 0.0152, 0.0609, 0.0006, 0.0386, 0.077, 0.6997, 0.2546, 0.4173, 0.0599, -0.0094, 0.0212, 0.0494, 0.0815, 0.4563, 0.1396, 0.0295, 0.4085, 0.1019, 0.2031, 0.5617, 1.3468, 0.6438, 0.914, 0.223, 0.192, 0.2305, -0.008, 0.1462, -0.0018, 0.1087, 0.1605, 0.6063, 0.4596, 0.5599, 0.3462, 0.171, -0.0158, -0.0474, 0.3966, 0.6586, 0.2946, 0.2026, 0.6463, 0.8563, 0.549, 0.4912, 0.5041, 0.7985, 0.0712, 0.109, 0.1283, 0.0966, 0.7171, 0.4932, 0.3136, 0.3174, 0.3629, 0.2449, 0.3337, 0.205, 0.2266, 0.0888, -0.0172, 0.0285, 0.0228, 0.0569, 0.2606, 0.1864, 0.158, 0, 0","SHAPE-threshold":"0.291","SHAPE-max":"0.534","SHAPE-min":"0.049","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.049,\"max\":0.534,\"threshold\":0.291,\"peaks\":[0.3432,0.9035,0.8572,0.5425,0.6674,0.2706,0.2147,0.6767,0.127,0.0152,0.0609,0.0006,0.0386,0.077,0.6997,0.2546,0.4173,0.0599,-0.0094,0.0212,0.0494,0.0815,0.4563,0.1396,0.0295,0.4085,0.1019,0.2031,0.5617,1.3468,0.6438,0.914,0.223,0.192,0.2305,-0.008,0.1462,-0.0018,0.1087,0.1605,0.6063,0.4596,0.5599,0.3462,0.171,-0.0158,-0.0474,0.3966,0.6586,0.2946,0.2026,0.6463,0.8563,0.549,0.4912,0.5041,0.7985,0.0712,0.109,0.1283,0.0966,0.7171,0.4932,0.3136,0.3174,0.3629,0.2449,0.3337,0.205,0.2266,0.0888,-0.0172,0.0285,0.0228,0.0569,0.2606,0.1864,0.158,0,0]}]"},{"title":"MOD of Ruler by Hoglahoo","id":"2889883","created":"1369446838","body":"similar to my 0.2\/0.4 loops design. Flipped GC's on the shorter stacks to get the 0.2 kcal loops ","sequence":"GGAAAGCAGAGACGAAAGUCUCAGCCGGGAAACCAGCACGAAAGUGCAGGCAAGCAAGAGGAAACUCAGCCACACUUCGGUGUGGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Hyphema","uid":"58224","picture":"sites\/default\/files\/pictures\/picture-58224.jpg","synthesis-score":"89","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"20","au":"6","meltpoint":"107.00","energy":"-53","has-fold-data":"0","SHAPE":"1, 0.2105, 0.9178, 0.7689, 1.029, 0.767, 0.3746, 0.2695, 0.2242, 0.163, 0.0753, 0.0547, 0.0547, 0.0205, 0.2228, 0.3835, 0.504, 0.3411, 0.1402, 0.0569, 0, 0.0799, 0.0798, 0.3177, 0.1585, 0.0396, 0, 0.2369, 0.1689, 1.015, 1.2172, 1.0092, 0.6044, 0.1479, 0.3313, 0.5117, 0.2549, -0.0626, 0.0364, 0.0182, 0.0505, 0.6683, 0.2982, 0.4622, 0.1503, 0.0085, 0.0472, 0.0825, 0.1529, 0.0434, 0.2107, 0.4884, 0.7252, 1.3553, 0.9034, 0.5808, 0.7716, 0.7794, 0.7724, 0.4466, 0.3502, 0.5039, 1.0837, 0.7646, 0.1832, 0.1815, 0.2426, 0.1211, 0.2079, 0.1186, -0.0333, 0.0882, 0.0563, 0.1374, 0.1185, 0.322, 0.5847, 0.2301, 0.5776, 0, 0","SHAPE-threshold":"0.334","SHAPE-max":"0.613","SHAPE-min":"0.056","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.056,\"max\":0.613,\"threshold\":0.334,\"peaks\":[0.2105,0.9178,0.7689,1.029,0.767,0.3746,0.2695,0.2242,0.163,0.0753,0.0547,0.0547,0.0205,0.2228,0.3835,0.504,0.3411,0.1402,0.0569,0,0.0799,0.0798,0.3177,0.1585,0.0396,0,0.2369,0.1689,1.015,1.2172,1.0092,0.6044,0.1479,0.3313,0.5117,0.2549,-0.0626,0.0364,0.0182,0.0505,0.6683,0.2982,0.4622,0.1503,0.0085,0.0472,0.0825,0.1529,0.0434,0.2107,0.4884,0.7252,1.3553,0.9034,0.5808,0.7716,0.7794,0.7724,0.4466,0.3502,0.5039,1.0837,0.7646,0.1832,0.1815,0.2426,0.1211,0.2079,0.1186,-0.0333,0.0882,0.0563,0.1374,0.1185,0.322,0.5847,0.2301,0.5776,0,0]}]"},{"title":"0.2 and 0.4 loops","id":"2889875","created":"1369446488","body":"nice and even stack energies, lower kcal loops on the shorter stacks. one GU incorporated","sequence":"GGAAAGCAGUAUCGAAAGGUACAGGCGGGAAACCAGUACGAAAGUACAGCCAAGCAAGCGGAAACGCAGAUACUCUUCGGAGUAUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Hyphema","uid":"58224","picture":"sites\/default\/files\/pictures\/picture-58224.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"1","gc":"17","au":"8","meltpoint":"97.00","energy":"-45.8","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Fruit Loops","id":"2888656","created":"1369428351","body":"lots of different closing pairs here. Let's see which ones work.","sequence":"GGAAAGCAGGUAUGAAAGUACCAGAGGCGAAAGCAGAUAGAAAUAUCACUCAAGCAAGAGGAAACUCAGAAUUGCUUCGGCAAUUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Darkfire47","uid":"61455","picture":"sites\/default\/files\/pictures\/picture-61455.png","synthesis-score":"87","synthesis-round":"1","submitted-round":"1","gu":"1","gc":"14","au":"11","meltpoint":"97.00","energy":"-37.9","has-fold-data":"0","SHAPE":"1, 0.9506, 0.6363, 1.2137, 0.6984, 0.7948, 0.3921, 0.5475, 0.3448, 0.052, 0.1683, 0.0393, 0.1638, 0.3158, 0.5373, 0.8805, 0.4218, 0.5183, 0.1439, 0.1798, 0.0997, -0.0642, 0.0818, 0.4171, 1.19, 0.3841, 0.8882, 0.1752, 0.1175, 0.3022, 0.8818, 0.3991, 0.5069, 0.312, 0.3692, 0.966, 0.0977, 0.3429, 0.1794, 0.1928, 0.3328, 0.5804, 0.351, 0.8085, 0.3107, 0.1878, 0.2722, 0.2647, 0.2299, 0.214, 0.3447, 0.3448, 0.5413, 0.7945, 0.5669, 0.435, 0.8895, 0.598, 0.7684, 0.2402, 0.3845, 0.406, 1.0345, 0.7305, 0.2513, 0.3092, 0.2782, 0.323, 0.4208, 0.1117, 0.1283, 0.116, 0.1566, 0.0383, 0.0721, 0.256, 0.5985, 0.1422, 0.2127, 0, 0","SHAPE-threshold":"0.384","SHAPE-max":"0.705","SHAPE-min":"0.064","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.064,\"max\":0.705,\"threshold\":0.384,\"peaks\":[0.9506,0.6363,1.2137,0.6984,0.7948,0.3921,0.5475,0.3448,0.052,0.1683,0.0393,0.1638,0.3158,0.5373,0.8805,0.4218,0.5183,0.1439,0.1798,0.0997,-0.0642,0.0818,0.4171,1.19,0.3841,0.8882,0.1752,0.1175,0.3022,0.8818,0.3991,0.5069,0.312,0.3692,0.966,0.0977,0.3429,0.1794,0.1928,0.3328,0.5804,0.351,0.8085,0.3107,0.1878,0.2722,0.2647,0.2299,0.214,0.3447,0.3448,0.5413,0.7945,0.5669,0.435,0.8895,0.598,0.7684,0.2402,0.3845,0.406,1.0345,0.7305,0.2513,0.3092,0.2782,0.323,0.4208,0.1117,0.1283,0.116,0.1566,0.0383,0.0721,0.256,0.5985,0.1422,0.2127,0,0]}]"},{"title":"GAAP - 1","id":"2888502","created":"1369425856","body":"No comment","sequence":"GGAAAGCAGUGACGAAAGUCACACAGGCGAAAGCAGUACGAAAGUACACUGAAGCAAGAGGAAACUCACAUAUAGUUCGCUAUAUGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"akhyatt","uid":"1623","picture":"","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"15","au":"11","meltpoint":"97.00","energy":"-38.1","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Triangle","id":"2887518","created":"1369410240","body":"no comment","sequence":"GGAAAGCAGAGACGAAAGUCUCAGCGGCGAAAGCAGUACGAAAGUACACGCAAGCAAGUCGAAAGACAGAGUGUCUUCGGACACUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"hoglahoo","uid":"36921","picture":"sites\/default\/files\/pictures\/picture-36921.gif","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"18","au":"8","meltpoint":"97.00","energy":"-48","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Scale","id":"2887512","created":"1369410214","body":"no comment","sequence":"GGAAACCAGAGACGAAAGUCUCAGCCGCGAAAGCAGCACGAAAGUGCAGGCAAGGAAGUCGAAAGACAGAGACACUUCGGUGUCUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"hoglahoo","uid":"36921","picture":"sites\/default\/files\/pictures\/picture-36921.gif","synthesis-score":"90","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"19","au":"7","meltpoint":"107.00","energy":"-50.5","has-fold-data":"0","SHAPE":"1, 0.3973, 0.2793, 1.0881, 0.8463, 1.025, 0.1966, 0.3175, 0.5399, 0, 0, 0.0792, 0.0668, 0.0456, 0.0667, 0.7261, 0.1647, 0.3115, 0.1146, 0.0327, 0.0109, -0.0218, -0.0217, 0.6153, 0.2099, 0.0263, 0.2028, 0.2562, 0.4455, 0.8802, 1.2725, 0.8989, 1.2525, 0.3377, 0.2277, 0.6507, 0.205, 0.0878, 0, -0.094, 0.4838, 0.7317, 0.4369, 0.4108, 0.0849, 0.0848, 0.0283, 0.1691, 0.1989, 0.4281, 0.1208, 0.3329, 0.4868, 0.5112, 0.4889, 0.9364, 1.1178, 1.5297, 0.356, 0.2297, 0.1528, 0.2411, 1.1075, 0.5206, 0.1892, 0.1881, 0.3669, 0.1465, 0.4126, 0.0193, -0.0049, 0.0242, -0.0291, 0.0726, 0.1689, 0.0964, 0.4198, 0.1433, 0.4508, 0, 0","SHAPE-threshold":"0.34","SHAPE-max":"0.623","SHAPE-min":"0.057","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.057,\"max\":0.623,\"threshold\":0.34,\"peaks\":[0.3973,0.2793,1.0881,0.8463,1.025,0.1966,0.3175,0.5399,0,0,0.0792,0.0668,0.0456,0.0667,0.7261,0.1647,0.3115,0.1146,0.0327,0.0109,-0.0218,-0.0217,0.6153,0.2099,0.0263,0.2028,0.2562,0.4455,0.8802,1.2725,0.8989,1.2525,0.3377,0.2277,0.6507,0.205,0.0878,0,-0.094,0.4838,0.7317,0.4369,0.4108,0.0849,0.0848,0.0283,0.1691,0.1989,0.4281,0.1208,0.3329,0.4868,0.5112,0.4889,0.9364,1.1178,1.5297,0.356,0.2297,0.1528,0.2411,1.1075,0.5206,0.1892,0.1881,0.3669,0.1465,0.4126,0.0193,-0.0049,0.0242,-0.0291,0.0726,0.1689,0.0964,0.4198,0.1433,0.4508,0,0]}]"},{"title":"Ruler","id":"2887509","created":"1369410189","body":"no comment","sequence":"GGAAAGCAGAGACGAAAGUCUCAGCCGCGAAAGCAGCACGAAAGUGCAGGCAAGCAAGUCGAAAGACAGGCACACUUCGGUGUGCCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"hoglahoo","uid":"36921","picture":"sites\/default\/files\/pictures\/picture-36921.gif","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"20","au":"6","meltpoint":"107.00","energy":"-52.8","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAAD LE alternate","id":"2887174","created":"1369404776","body":"No comment","sequence":"GGAAAGCAGCGCCGAAAGGCGCAGCGCCGAAAGGAGCGCGAAAGCGCACGCAAGCAACGCGAAAGCGAGCGCCGGUUCGCCGGCGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Billy Reuben","uid":"51350","picture":"sites\/default\/files\/pictures\/picture-51350.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"26","au":"0","meltpoint":"107.00","energy":"-57.3","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAAD LE","id":"2887172","created":"1369404749","body":"No comment","sequence":"GGAAAGCAGCGCCGAAAGGCGCAGCGCCGAAAGGAGCGCGAAAGCGCACGCAAGCAACGCGAAAGCGAGCGCGCCUUCGGGCGCGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Billy Reuben","uid":"51350","picture":"sites\/default\/files\/pictures\/picture-51350.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"26","au":"0","meltpoint":"107.00","energy":"-60","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAAD","id":"2887168","created":"1369404658","body":"No comment","sequence":"GGAAAGCAUAUAAGAAAUUAUAAGCGCAGAAAUGAUAUAGAAAUAUAACGCAAGCAAAUAGAAAUAUAAUAUACGUUCGCGUAUAUAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Billy Reuben","uid":"51350","picture":"sites\/default\/files\/pictures\/picture-51350.jpg","synthesis-score":"77","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"8","au":"18","meltpoint":"77.00","energy":"-16.7","has-fold-data":"0","SHAPE":"1, 0.8808, 0.5314, 1.1055, 1.3686, 1.1705, 0.0573, 0.3292, 1.176, 0.0479, 0.2634, 0.2193, 0.5631, 0.1462, 0.6995, 1.0299, 0.4819, 0.477, 0.3372, 0.4909, 0.3518, 0.1536, 0.394, 0.7126, 0.2579, 0.3209, 0.3195, 0.3176, 0.7235, 1.3247, 1.8582, 0.8262, 1.2816, 0.2323, 0.9103, 1.7153, 1.1534, 1.0087, 0.2578, 0.8224, 0.8081, 0.9865, 0.9464, 0.8279, 0.7166, 0.3684, 0.6287, 0.8521, 0.8229, 0.1824, 0.5555, 0.4353, 0.8447, 1.4153, 0.9621, 0.9478, 0.9958, 0.9764, 1.5783, 0.7972, 0.6112, 1.6744, 1.3455, 1.4928, 1.4009, 0.9254, 1.1497, 0.9332, 0.8947, 0.84, 0.3483, 0.2776, 0.127, 0.2826, 0.2399, 0.205, 0.8442, 0.1012, 0.2134, 0, 0","SHAPE-threshold":"0.716","SHAPE-max":"1.313","SHAPE-min":"0.119","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.119,\"max\":1.313,\"threshold\":0.716,\"peaks\":[0.8808,0.5314,1.1055,1.3686,1.1705,0.0573,0.3292,1.176,0.0479,0.2634,0.2193,0.5631,0.1462,0.6995,1.0299,0.4819,0.477,0.3372,0.4909,0.3518,0.1536,0.394,0.7126,0.2579,0.3209,0.3195,0.3176,0.7235,1.3247,1.8582,0.8262,1.2816,0.2323,0.9103,1.7153,1.1534,1.0087,0.2578,0.8224,0.8081,0.9865,0.9464,0.8279,0.7166,0.3684,0.6287,0.8521,0.8229,0.1824,0.5555,0.4353,0.8447,1.4153,0.9621,0.9478,0.9958,0.9764,1.5783,0.7972,0.6112,1.6744,1.3455,1.4928,1.4009,0.9254,1.1497,0.9332,0.8947,0.84,0.3483,0.2776,0.127,0.2826,0.2399,0.205,0.8442,0.1012,0.2134,0,0]}]"},{"title":"GAAA loop V.2","id":"2885745","created":"1369354288","body":"A mix of GC and UA closing pairs.","sequence":"GGAAAGCAGGAUAGAAAUAUCCAGGCGCGAAAGCAGAUAGAAAUAUCAGCCAAGCAAGUGGAAACACAGUAAUUCUUCGGAAUUACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"nihilnove","uid":"91837","picture":"sites\/default\/files\/pictures\/picture-91837.jpg","synthesis-score":"91","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"14","au":"12","meltpoint":"87.00","energy":"-38.1","has-fold-data":"0","SHAPE":"1, 0.6198, 0.6251, 1.2578, 0.8221, 0.5297, 0.0616, 0.1052, 0.1965, 0.1324, 0.122, 0.0329, 0.1823, 0.0607, 0.2721, 0.9253, 0.298, 0.6184, 0.2933, 0.0391, 0.0392, 0.0293, 0.039, 0.3005, 0.644, 0.1822, 0.2294, 0.0573, 0.0954, 0.1807, 0.6251, 0.3627, 0.4739, 0.0835, 0.0531, 0.1941, -0.0053, 0.0802, 0.0828, 0.0523, 0.171, 0.6554, 0.175, 0.5585, 0.1611, 0.0562, 0, 0.1071, 0.7157, 0.1851, 0.0264, 0.0528, 0.195, 0.5735, 0.1301, 0.4591, 0.5572, 1.0769, 0.5752, 0.1995, 0.2485, 0.223, 0.5323, 0.5002, 0.2311, 0.2574, 0.364, 0.1714, 0.8166, 0.1784, 0.0136, 0.0939, 0.0269, 0.2001, 0, 0.1863, 0.6353, 0.0691, 0.2068, 0, 0","SHAPE-threshold":"0.26","SHAPE-max":"0.477","SHAPE-min":"0.043","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.043,\"max\":0.477,\"threshold\":0.26,\"peaks\":[0.6198,0.6251,1.2578,0.8221,0.5297,0.0616,0.1052,0.1965,0.1324,0.122,0.0329,0.1823,0.0607,0.2721,0.9253,0.298,0.6184,0.2933,0.0391,0.0392,0.0293,0.039,0.3005,0.644,0.1822,0.2294,0.0573,0.0954,0.1807,0.6251,0.3627,0.4739,0.0835,0.0531,0.1941,-0.0053,0.0802,0.0828,0.0523,0.171,0.6554,0.175,0.5585,0.1611,0.0562,0,0.1071,0.7157,0.1851,0.0264,0.0528,0.195,0.5735,0.1301,0.4591,0.5572,1.0769,0.5752,0.1995,0.2485,0.223,0.5323,0.5002,0.2311,0.2574,0.364,0.1714,0.8166,0.1784,0.0136,0.0939,0.0269,0.2001,0,0.1863,0.6353,0.0691,0.2068,0,0]}]"},{"title":"Lady GAAA GAAA","id":"2885293","created":"1369342643","body":"No comment","sequence":"GGAAAGCAGGAUGGAAACAUCCAGUCGCGAAAGCAGAUGGAAACAUCAGACAAGCAAGAGGAAACUCAGCUCUUCUUCGGAAGAGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"garydfisher","uid":"57654","picture":"","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"17","au":"9","meltpoint":"107.00","energy":"-46.9","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Rareedte","id":"2885008","created":"1369339039","body":"For the record, I chose this sequence out of 26872 valid ones, and wasted 143980 simulations and 7215 seconds doing only that. *sigh*\r\r[1] -37.28\r.....((.(((((....))))).(((((....)).((((....)))).)))..))..(((....))).(((((((....))))))).....................\r[EDPF] 0.952\r","sequence":"GGAAACCAGUCACGAAAGUGACGCGCGGGAAACCACAUAGAAAUAUGAGCGAGGGAAGACGAAAGUCACUUGGCCUUCGGGCCAAGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"ViennaUCT","uid":"61031","picture":"sites\/default\/files\/pictures\/picture-61031.png","synthesis-score":"86","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"18","au":"8","meltpoint":"82.00","energy":"-37.28","has-fold-data":"0","SHAPE":"1, 0.4112, 0.2423, 0.7272, 0.9298, 0.2575, 0.0865, 0.1357, 0.4507, 0.1223, 0.0245, -0.0055, 0.0244, -0.015, 0.1948, 0.7947, 0.1972, 0.291, 0.0557, 0.0318, 0.0084, 0, 0.0404, 0.7302, 0.6374, 0.7443, 0.3139, 0.107, 0.1438, 0.5448, 0.7741, 0.6826, 0.4571, 0.054, 0.3115, 0.2708, 0.0554, 0.2963, 0.2263, 0.2256, 0.1831, 0.6363, 0.4426, 0.6061, 0.32, 0.2071, 0.0054, 0.4102, 1.1598, 0.6085, 0.4495, 0.8762, 0.4784, 0.1562, 0.3681, 0.7759, 1.0649, 0.5786, 0.5516, 0.2585, 0.1824, 0.348, 0.8837, 0.5562, 0.6225, 0.3156, 0.1589, 0.0467, 0.1408, 0.1339, 0.0438, -0.0567, 0.07, 0.0491, 0.0873, 0.3127, 0.3897, 0.0517, 0.4287, 0, 0","SHAPE-threshold":"0.328","SHAPE-max":"0.601","SHAPE-min":"0.055","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.055,\"max\":0.601,\"threshold\":0.328,\"peaks\":[0.4112,0.2423,0.7272,0.9298,0.2575,0.0865,0.1357,0.4507,0.1223,0.0245,-0.0055,0.0244,-0.015,0.1948,0.7947,0.1972,0.291,0.0557,0.0318,0.0084,0,0.0404,0.7302,0.6374,0.7443,0.3139,0.107,0.1438,0.5448,0.7741,0.6826,0.4571,0.054,0.3115,0.2708,0.0554,0.2963,0.2263,0.2256,0.1831,0.6363,0.4426,0.6061,0.32,0.2071,0.0054,0.4102,1.1598,0.6085,0.4495,0.8762,0.4784,0.1562,0.3681,0.7759,1.0649,0.5786,0.5516,0.2585,0.1824,0.348,0.8837,0.5562,0.6225,0.3156,0.1589,0.0467,0.1408,0.1339,0.0438,-0.0567,0.07,0.0491,0.0873,0.3127,0.3897,0.0517,0.4287,0,0]}]"},{"title":"Orriquenma","id":"2884477","created":"1369331380","body":"For the record, I chose this sequence out of 30940 valid ones, and wasted 2089 simulations and 7213 seconds doing only that. *sigh*\r\r[1] -39.49\r.....((.(((((....))))).(((((....)).((((....)))).)))..))..(((....))).(((((((....))))))).....................\r[EDPF] 0.953\r","sequence":"GGAAACCACCCGCGAAAGCGGGACCGGCGAAAGCAUCAUGAAAAUGAACGGAGGGAAGGCGAAAGCCACUUGUUCUUCGGAACAAGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"ViennaUCT","uid":"61031","picture":"sites\/default\/files\/pictures\/picture-61031.png","synthesis-score":"85","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"19","au":"7","meltpoint":"59.00","energy":"-39.49","has-fold-data":"0","SHAPE":"1, 0.5413, 0.5028, 0.7512, 0.5344, 0.5109, 0, 0.339, 0.2533, 0.0843, -0.0658, -0.0236, 0, 0, 0.0421, 0.6677, 0.308, 0.4128, 0.1236, 0, 0, 0, 0.0743, 0.5206, 0.2589, 0.2424, 0.4815, 0.1202, 0.438, 0.3897, 0.9179, 0.7282, 0.9575, 0.1375, 0.715, 1.2283, 0.0995, 0.4981, 0.2874, 0.2241, 0.5616, 1.1365, 0.6732, 0.8523, 0.3382, 0.1477, 0.1566, 0.6065, 0.3521, 0.2672, 0.4976, 0.4778, 0.5721, 0.3578, 0.3883, 0.7999, 0.7598, 0.4388, 0.1849, 0.0625, 0.2182, 0.2486, 0.7989, 0.6395, 0.3937, 0.2114, 0.0302, -0.0074, 0.2702, 0.0859, -0.0339, 0, 0.0299, 0.1792, 0.0597, 0.1489, 0.7367, 0.1764, 0.1414, 0, 0","SHAPE-threshold":"0.339","SHAPE-max":"0.621","SHAPE-min":"0.056","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.056,\"max\":0.621,\"threshold\":0.339,\"peaks\":[0.5413,0.5028,0.7512,0.5344,0.5109,0,0.339,0.2533,0.0843,-0.0658,-0.0236,0,0,0.0421,0.6677,0.308,0.4128,0.1236,0,0,0,0.0743,0.5206,0.2589,0.2424,0.4815,0.1202,0.438,0.3897,0.9179,0.7282,0.9575,0.1375,0.715,1.2283,0.0995,0.4981,0.2874,0.2241,0.5616,1.1365,0.6732,0.8523,0.3382,0.1477,0.1566,0.6065,0.3521,0.2672,0.4976,0.4778,0.5721,0.3578,0.3883,0.7999,0.7598,0.4388,0.1849,0.0625,0.2182,0.2486,0.7989,0.6395,0.3937,0.2114,0.0302,-0.0074,0.2702,0.0859,-0.0339,0,0.0299,0.1792,0.0597,0.1489,0.7367,0.1764,0.1414,0,0]}]"},{"title":"kcab - GAAA loop 3","id":"2877144","created":"1369188049","body":"Flipped some GCs and added a GU pair. -43.3 kcal.","sequence":"GGAAAGCAGUUGCGAAAGCGACAGACGGGAAACCAGUAGGAAACUACAGUCAAGCAACGAGAAAUCGACAGAGACUUCGGUCUCUGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"kcabral28","uid":"64124","picture":"sites\/default\/files\/pictures\/picture-64124.jpg","synthesis-score":"89","synthesis-round":"1","submitted-round":"1","gu":"1","gc":"17","au":"8","meltpoint":"97.00","energy":"-43.3","has-fold-data":"0","SHAPE":"1, 0.5199, 0.8261, 0.851, 0.6017, 0.67, 0.4332, 0.5026, 1.2584, 0.2094, 0.1393, -0.0063, 0.0282, 0.1315, 0.5339, 0.8988, 0.6651, 0.7254, 0.3081, 0.685, 0.2793, 0.1376, 0.2859, 0.4334, 0.9902, 0.6525, 0.2716, 0.1065, 0.2383, 0.4403, 0.8017, 0.7394, 0.463, 0.1595, 0.5029, 1.0354, 0.3956, 0.1534, 0.1192, 0.1686, 0.2824, 0.8796, 0.7063, 0.3682, 0.2513, 0.1822, 0.2186, 0.1149, 0.73, 0.3772, 0.0703, 0.1989, 0.6691, 1.8018, 0.213, 0.1238, 0.3858, 0.2588, 0.1631, 0.4085, 0.7752, 1.0202, 1.6191, 0.6489, 0.6341, 0.176, 0.074, 0.275, 0.3425, 0.1239, 0.061, 0.0495, -0.0018, 0.1716, 0.0123, 0.1353, 0.3659, 0.0733, 0.218, 0, 0","SHAPE-threshold":"0.415","SHAPE-max":"0.762","SHAPE-min":"0.069","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.069,\"max\":0.762,\"threshold\":0.415,\"peaks\":[0.5199,0.8261,0.851,0.6017,0.67,0.4332,0.5026,1.2584,0.2094,0.1393,-0.0063,0.0282,0.1315,0.5339,0.8988,0.6651,0.7254,0.3081,0.685,0.2793,0.1376,0.2859,0.4334,0.9902,0.6525,0.2716,0.1065,0.2383,0.4403,0.8017,0.7394,0.463,0.1595,0.5029,1.0354,0.3956,0.1534,0.1192,0.1686,0.2824,0.8796,0.7063,0.3682,0.2513,0.1822,0.2186,0.1149,0.73,0.3772,0.0703,0.1989,0.6691,1.8018,0.213,0.1238,0.3858,0.2588,0.1631,0.4085,0.7752,1.0202,1.6191,0.6489,0.6341,0.176,0.074,0.275,0.3425,0.1239,0.061,0.0495,-0.0018,0.1716,0.0123,0.1353,0.3659,0.0733,0.218,0,0]}]"},{"title":"kcab - GAAA loop 2 ","id":"2877138","created":"1369187818","body":"Very clean dot plot. -47 kcal.","sequence":"GGAAAGCAGUGACGAAAGUCACAGACGCGAAAGCAGUAGGAAACUACAGUCAAGCAACGCGAAAGCGAGUGAGGCUUCGGUCUCACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"kcabral28","uid":"64124","picture":"sites\/default\/files\/pictures\/picture-64124.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"1","gc":"18","au":"7","meltpoint":"97.00","energy":"-47","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"kcab - GAAA loop 1 ","id":"2877129","created":"1369187650","body":"-45.6 kcal. Clean plots. I added a couple of Us to one of the multiloops.","sequence":"GGAAACCAGUGACGAAAGUCGCAGACGCGAAAGCUGCAGGAAACUGCUGUCAAGGAACUGGAAACGGAGUGAUGCUUCGGCAUCACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"kcabral28","uid":"64124","picture":"sites\/default\/files\/pictures\/picture-64124.jpg","synthesis-score":"78","synthesis-round":"1","submitted-round":"1","gu":"2","gc":"18","au":"6","meltpoint":"107.00","energy":"-45.6","has-fold-data":"0","SHAPE":"1, 0.6233, 0.3636, 1.119, 0.7947, 0.2825, 0.0178, 0.0535, 0.1155, 0.0533, 0.1242, 0.5109, 0.1665, 0.0868, 0.4735, 0.7509, 0.6371, 0.66, 0.6086, 0.068, 0.0951, 0.1413, 0.2321, 0.5674, 2.1769, 0.5635, 0.6371, 0.2618, 0.14, 0.303, 0.4124, 0.7201, 0.4387, 0.3572, 0.1646, 0.1676, 0.2084, 0.0182, 0.0941, 0.0676, 0.3388, 1.1963, 0.6534, 0.5322, 0.0996, 0.0569, 0.0326, 0.0588, 0.2981, 0.4639, 0.8577, 0.6359, 0.7723, 0.371, 0.166, 0.6448, 0.9057, 0.3208, 0.1046, 0.0522, 0.1043, 0.0779, 1.0394, 0.7431, 0.602, 0.1754, 0.3975, 0.6204, 0.7073, 0.4809, 0.1209, 0.1289, 0.0583, 0.7403, 0.4877, 0.5544, 1.4012, 0.2627, 0.2277, 0, 0","SHAPE-threshold":"0.404","SHAPE-max":"0.74","SHAPE-min":"0.067","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.067,\"max\":0.74,\"threshold\":0.404,\"peaks\":[0.6233,0.3636,1.119,0.7947,0.2825,0.0178,0.0535,0.1155,0.0533,0.1242,0.5109,0.1665,0.0868,0.4735,0.7509,0.6371,0.66,0.6086,0.068,0.0951,0.1413,0.2321,0.5674,2.1769,0.5635,0.6371,0.2618,0.14,0.303,0.4124,0.7201,0.4387,0.3572,0.1646,0.1676,0.2084,0.0182,0.0941,0.0676,0.3388,1.1963,0.6534,0.5322,0.0996,0.0569,0.0326,0.0588,0.2981,0.4639,0.8577,0.6359,0.7723,0.371,0.166,0.6448,0.9057,0.3208,0.1046,0.0522,0.1043,0.0779,1.0394,0.7431,0.602,0.1754,0.3975,0.6204,0.7073,0.4809,0.1209,0.1289,0.0583,0.7403,0.4877,0.5544,1.4012,0.2627,0.2277,0,0]}]"},{"title":"JR_GAAA_Rnd1_Sub3","id":"2876842","created":"1369182420","body":"Closed hairpins with AU pairs.","sequence":"GGAAAGCACGUGUGAAAACACGACCGGAGAAAUCAGCCAGAAAUGGCACGGAAGCAACGAGAAAUCGAGACAUCAUUCGUGAUGUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"JR","uid":"42833","picture":"sites\/default\/files\/pictures\/picture-42833.png","synthesis-score":"87","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"17","au":"9","meltpoint":"87.00","energy":"-34.6","has-fold-data":"0","SHAPE":"1, 1.1038, 0.8806, 1.0397, 0.6758, 0.5674, 0.2515, 0.3336, 0.3953, 0.0188, 0.0825, -0.0225, 0.0094, 0.2967, 0.336, 0.7766, 0.2856, 0.7754, 0.3481, 0.0922, 0.0466, 0.0132, 0.2353, 0.5956, 0.1276, 0.0389, 0.2017, 0.8789, 0.5458, 1.7765, 1.2832, 1.1243, 1.2427, 0.5009, 0.4631, 0.8373, 0.091, -0.0066, 0.0275, 0.0785, 0.213, 0.7653, 0.5596, 0.4868, 0.1309, 0.0246, -0.0179, 0.0447, 0.3971, 0.1379, 0.2136, 0.5277, 0.6134, 1.1719, 0.2925, 0.5083, 0.7087, 0.4032, 0.3151, 0.6908, 0.6399, 0.9214, 1.6433, 0.7301, 0.6651, 0.2633, 0.0593, 0.2549, 0.4855, 0.1953, 0.1474, 0.0467, 0.0668, 0.0373, 0.1496, 0.4408, 0.7194, 0.2066, 0.5039, 0, 0","SHAPE-threshold":"0.42","SHAPE-max":"0.769","SHAPE-min":"0.07","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.07,\"max\":0.769,\"threshold\":0.42,\"peaks\":[1.1038,0.8806,1.0397,0.6758,0.5674,0.2515,0.3336,0.3953,0.0188,0.0825,-0.0225,0.0094,0.2967,0.336,0.7766,0.2856,0.7754,0.3481,0.0922,0.0466,0.0132,0.2353,0.5956,0.1276,0.0389,0.2017,0.8789,0.5458,1.7765,1.2832,1.1243,1.2427,0.5009,0.4631,0.8373,0.091,-0.0066,0.0275,0.0785,0.213,0.7653,0.5596,0.4868,0.1309,0.0246,-0.0179,0.0447,0.3971,0.1379,0.2136,0.5277,0.6134,1.1719,0.2925,0.5083,0.7087,0.4032,0.3151,0.6908,0.6399,0.9214,1.6433,0.7301,0.6651,0.2633,0.0593,0.2549,0.4855,0.1953,0.1474,0.0467,0.0668,0.0373,0.1496,0.4408,0.7194,0.2066,0.5039,0,0]}]"},{"title":"JR_GAAA_Rnd1_Sub2","id":"2876808","created":"1369181753","body":",.,.,.,.,.,.,.,.,.,.,.,.","sequence":"GGAAAGCACGUAGGAAACUACGACCGGAGAAAUCACUUGGAAACAAGACGGAAGCAACUAGAAAUAGAUACAUCAUUCGUGAUGUAAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"JR","uid":"42833","picture":"sites\/default\/files\/pictures\/picture-42833.png","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"14","au":"12","meltpoint":"87.00","energy":"-30.3","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"3rdPass-GAAALoop","id":"2876168","created":"1369169425","body":"No comment","sequence":"GGAAAGCAGAUACGAAAGUAUCAGACGGGAAACCAGAUCGAAAGAUCAGUCAAGCAAGCGGAAAUGCAAGUAUACUUCGGUAUACUAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"eternacac","uid":"55836","picture":"sites\/default\/files\/pictures\/picture-55836.gif","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"1","gc":"14","au":"11","meltpoint":"97.00","energy":"-36.2","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"2ndPass-GAAALoop","id":"2876157","created":"1369169253","body":"No comment","sequence":"GGAAAGCAAUAAUGAAAAUUAUAGACGCGAAAGCAGAUGGAAACAUCAGUCAAGCAAGAUGAAAGUCAAAUAUCGUUCGCGAUAUUAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"eternacac","uid":"55836","picture":"sites\/default\/files\/pictures\/picture-55836.gif","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"1","gc":"11","au":"14","meltpoint":"87.00","energy":"-26.9","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"Lab The GAAA Loop","id":"2875393","created":"1369159505","body":"No comment","sequence":"GGAAAGCAAUUUAGAAAUAGGUAGUCGAGAAAUCAUAUUGAAAGAUAAGACAAGCAAAUAGAAAUGUAGAUCCUUUUCGAAGGAUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"DHammond","uid":"41429","picture":"","synthesis-score":"78","synthesis-round":"1","submitted-round":"1","gu":"4","gc":"8","au":"14","meltpoint":"77.00","energy":"-17.8","has-fold-data":"0","SHAPE":"1, 0.8197, 1.1241, 0.8256, 0.7695, 0.7531, 0.4767, 0.2875, 1.0728, 1.1866, 1.0428, 1.1257, 0.9705, 0.8544, 1.3782, 1.2188, 0.9709, 1.1765, 1.2077, 0.4766, 0.8992, 0.9964, 0.9231, 0.9878, 0.5538, 0.0857, 0.1012, 0.5677, 0.7888, 1.4266, 1.7549, 1.4875, 1.4743, 0.3874, 0.7433, 1.6475, 0.4947, 2.3196, 1.8119, 0.7788, 1.3403, 1.1882, 1.4793, 0.9748, 0.7247, 0.7492, 0.6592, 0.9924, 0.8681, 0.4911, 0.3057, 0.2101, 1.0043, 1.482, 0.6526, 0.7655, 1.0345, 1.342, 1.5765, 1.0267, 1.1556, 0.8776, 1.5287, 0.9769, 0.9153, 0.6159, 0.9766, 0.6582, 0.6522, 0.0993, 0.1177, 0.0822, 0.0265, 0.1603, 0.0678, 0.6168, 0.814, 0.2822, 0.5542, 0, 0","SHAPE-threshold":"0.871","SHAPE-max":"1.597","SHAPE-min":"0.145","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.145,\"max\":1.597,\"threshold\":0.871,\"peaks\":[0.8197,1.1241,0.8256,0.7695,0.7531,0.4767,0.2875,1.0728,1.1866,1.0428,1.1257,0.9705,0.8544,1.3782,1.2188,0.9709,1.1765,1.2077,0.4766,0.8992,0.9964,0.9231,0.9878,0.5538,0.0857,0.1012,0.5677,0.7888,1.4266,1.7549,1.4875,1.4743,0.3874,0.7433,1.6475,0.4947,2.3196,1.8119,0.7788,1.3403,1.1882,1.4793,0.9748,0.7247,0.7492,0.6592,0.9924,0.8681,0.4911,0.3057,0.2101,1.0043,1.482,0.6526,0.7655,1.0345,1.342,1.5765,1.0267,1.1556,0.8776,1.5287,0.9769,0.9153,0.6159,0.9766,0.6582,0.6522,0.0993,0.1177,0.0822,0.0265,0.1603,0.0678,0.6168,0.814,0.2822,0.5542,0,0]}]"},{"title":"quiet gah","id":"2874815","created":"1369149686","body":"No comment","sequence":"GGAAAGCAGCUGCGAAAGUAGCAGACGCGAAAGCAGUACGAAAGUACAGUCAAGCAAGACGAAAGUCAGUCAUGCUUCGGCAUGACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"wilf","uid":"69071","picture":"sites\/default\/files\/pictures\/picture-69071.jpg","synthesis-score":"83","synthesis-round":"1","submitted-round":"1","gu":"1","gc":"17","au":"8","meltpoint":"97.00","energy":"-46.6","has-fold-data":"0","SHAPE":"1, 0.895, 0.6319, 1.1778, 0.6364, 1.0006, 0.1721, 0.2085, 0.7216, 0.1694, 0.0282, 0.0501, 0.0845, 0.1061, 0.4518, 1.3663, 1.4244, 1.2689, 0.9739, 0.6945, 1.0799, 0.1264, 0.1262, 0.1259, 0.5251, 0.546, 0.213, 0.0988, 0.0987, 0.4069, 1.7816, 0.9665, 0.9766, 0.5081, 0.3102, 0.8611, 0.1131, 0.0896, 0.0677, 0.0676, 0.3127, 0.7211, 0.5541, 0.5807, 0.2971, 0.2059, 0.2377, 0.1168, 0.9573, 1.0554, 0.6405, 0.4709, 0.9146, 1.2766, 0.6527, 0.6662, 0.737, 0.4763, 0.2378, 0.2903, 0.1902, 0.463, 1.1362, 0.4822, 0.6598, 0.3813, 0.3433, 0.2401, 0.5954, 0.1485, -0.032, 0.089, 0.0905, 0.1787, 0.159, 0.0882, 0.5286, 0.1223, 0.261, 0, 0","SHAPE-threshold":"0.478","SHAPE-max":"0.876","SHAPE-min":"0.08","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.08,\"max\":0.876,\"threshold\":0.478,\"peaks\":[0.895,0.6319,1.1778,0.6364,1.0006,0.1721,0.2085,0.7216,0.1694,0.0282,0.0501,0.0845,0.1061,0.4518,1.3663,1.4244,1.2689,0.9739,0.6945,1.0799,0.1264,0.1262,0.1259,0.5251,0.546,0.213,0.0988,0.0987,0.4069,1.7816,0.9665,0.9766,0.5081,0.3102,0.8611,0.1131,0.0896,0.0677,0.0676,0.3127,0.7211,0.5541,0.5807,0.2971,0.2059,0.2377,0.1168,0.9573,1.0554,0.6405,0.4709,0.9146,1.2766,0.6527,0.6662,0.737,0.4763,0.2378,0.2903,0.1902,0.463,1.1362,0.4822,0.6598,0.3813,0.3433,0.2401,0.5954,0.1485,-0.032,0.089,0.0905,0.1787,0.159,0.0882,0.5286,0.1223,0.261,0,0]}]"},{"title":"G3AAA - Brourd - Lab 'The GAAA loop' R1 - Sub 3 (Extra G-C pairs)","id":"2874172","created":"1369119898","body":"No comment","sequence":"GGAAAGCAGAUGGGAAACCAUCAGGCCCGAAAGGUGAGCGAAAGCUCUGCCAAGCAAGCCGAAAGGCACUACGACUUCGGUCGUAGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Brourd","uid":"24263","picture":"sites\/default\/files\/pictures\/picture-24263.png","synthesis-score":"91","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"20","au":"6","meltpoint":"107.00","energy":"-50.1","has-fold-data":"0","SHAPE":"1, 0.8606, 0.4897, 1.0637, 1.0238, 0.7275, 0.1079, 0.1077, 0.4183, 0.0778, 0.0367, 0.0621, 0, 0.0931, 0.1193, 0.4815, 0.4428, 0.4853, 0.0529, 0.0831, 0.0298, 0.1132, 0.1252, 0.1719, 0.2563, 0.1467, 0.0387, 0.0819, 0.3647, 0.8225, 1.0231, 0.7628, 0.3535, 0.1444, 0.2326, 0.0493, 0.0563, -0.0559, 0.0422, 0.073, 0.0267, 0.4138, 0.3779, 0.197, 0.0414, 0.0162, 0.0414, 0.1239, 0.5425, 0.6344, 0.0854, 0.1185, 0.5792, 0.8677, 0.4913, 0.7236, 0.7464, 0.8596, 0.164, 0.0755, 0.1256, 0.2504, 0.5955, 0.2843, 0.1726, 0.0862, 0.0984, 0.0856, 0.1583, 0.0729, 0.0728, 0.1462, 0.0232, 0.1687, 0.1091, 0.2039, 0.5599, 0.1413, 0.3197, 0, 0","SHAPE-threshold":"0.257","SHAPE-max":"0.47","SHAPE-min":"0.043","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.043,\"max\":0.47,\"threshold\":0.257,\"peaks\":[0.8606,0.4897,1.0637,1.0238,0.7275,0.1079,0.1077,0.4183,0.0778,0.0367,0.0621,0,0.0931,0.1193,0.4815,0.4428,0.4853,0.0529,0.0831,0.0298,0.1132,0.1252,0.1719,0.2563,0.1467,0.0387,0.0819,0.3647,0.8225,1.0231,0.7628,0.3535,0.1444,0.2326,0.0493,0.0563,-0.0559,0.0422,0.073,0.0267,0.4138,0.3779,0.197,0.0414,0.0162,0.0414,0.1239,0.5425,0.6344,0.0854,0.1185,0.5792,0.8677,0.4913,0.7236,0.7464,0.8596,0.164,0.0755,0.1256,0.2504,0.5955,0.2843,0.1726,0.0862,0.0984,0.0856,0.1583,0.0729,0.0728,0.1462,0.0232,0.1687,0.1091,0.2039,0.5599,0.1413,0.3197,0,0]}]"},{"title":"G2AA - Brourd - Lab 'The GAAA loop' R1 - Sub 2 (CGAAAG closing pairs)","id":"2874167","created":"1369119748","body":"No comment","sequence":"GGAAAGCAGACUCGAAAGAGUCAGACGCGAAAGCAGCUCGAAAGAGCAGUCAAGCAAGACGAAAGUCACUAGGACUUCGGUCCUAGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Brourd","uid":"24263","picture":"sites\/default\/files\/pictures\/picture-24263.png","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"18","au":"8","meltpoint":"107.00","energy":"-48.4","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"G1A - Brourd - Lab 'The GAAA loop' R1 - Sub 1 (GGAAAC closing pairs)","id":"2874165","created":"1369119682","body":"No comment","sequence":"GGAAAGCAGACUGGAAACAGUCAGACGGGAAACCAGCUGGAAACAGCAGUCAAGCAAGAGGAAACUCAGUCAGUCUUCGGACUGACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Brourd","uid":"24263","picture":"sites\/default\/files\/pictures\/picture-24263.png","synthesis-score":"89","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"18","au":"8","meltpoint":"107.00","energy":"-49","has-fold-data":"0","SHAPE":"1, 0.1114, 0.5748, 0.9822, 0.7543, 0.7518, 0.3135, 0.2683, 0.3418, 0.2163, 0.0638, -0.0144, -0.039, 0.0141, 0.5053, 0.8832, 0.1984, 0.3936, 0.1439, 0.1845, 0.4482, 0.225, 0.1485, 0.5395, 0.764, 0.6496, 0.333, 0.127, 0.2402, 0.776, 1.066, 0.7945, 0.8054, 0.0705, 0.3127, 0.4456, 0.08, 0.0729, 0.0182, 0.0342, 0.5465, 0.9418, 0.5709, 0.3827, 0.1366, 0.1362, 0.3477, 0.2051, 0.3993, 0.4823, 0.1847, 0.2751, 0.8859, 0.9571, 0.4531, 0.4229, 0.9462, 0.6258, 0.9732, 0.3521, 0.4426, 0.4009, 1.2269, 0.7485, 0.3706, 0.1973, 0.2659, 0.2942, 0.4007, 0.2968, 0.1307, 0.0056, 0.0346, 0.2237, 0.1009, 0.192, 0.6309, 0.1703, 0.2405, 0, 0","SHAPE-threshold":"0.39","SHAPE-max":"0.714","SHAPE-min":"0.065","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.065,\"max\":0.714,\"threshold\":0.39,\"peaks\":[0.1114,0.5748,0.9822,0.7543,0.7518,0.3135,0.2683,0.3418,0.2163,0.0638,-0.0144,-0.039,0.0141,0.5053,0.8832,0.1984,0.3936,0.1439,0.1845,0.4482,0.225,0.1485,0.5395,0.764,0.6496,0.333,0.127,0.2402,0.776,1.066,0.7945,0.8054,0.0705,0.3127,0.4456,0.08,0.0729,0.0182,0.0342,0.5465,0.9418,0.5709,0.3827,0.1366,0.1362,0.3477,0.2051,0.3993,0.4823,0.1847,0.2751,0.8859,0.9571,0.4531,0.4229,0.9462,0.6258,0.9732,0.3521,0.4426,0.4009,1.2269,0.7485,0.3706,0.1973,0.2659,0.2942,0.4007,0.2968,0.1307,0.0056,0.0346,0.2237,0.1009,0.192,0.6309,0.1703,0.2405,0,0]}]"},{"title":"GAAAAAH! - 3","id":"2873859","created":"1369107612","body":"Dot still great.. lighter than 2 w\/ 10\/21 & 12\/19 Mutated to AU ","sequence":"GGAAAGCAGUGACGAAAGUCACACAGGCGAAAGCAGUGCGAAAGCACACUGAAGCAAGAGGAAACUCAGUAGUACUUCGGUACUACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Jieux","uid":"48170","picture":"sites\/default\/files\/pictures\/picture-48170.png","synthesis-score":"87","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"17","au":"9","meltpoint":"97.00","energy":"-45.6","has-fold-data":"0","SHAPE":"1, -0.4546, 1.2887, 0.6689, 0.6955, 0.6254, 0.3603, 0.0109, 0.6638, 0.0324, -0.0033, 0.0256, 0.0323, 0.0966, 0.0429, 0.4584, 0.3923, 0.3009, 0.0475, 0.0948, -0.0362, 0.0947, 0.1583, 0.5608, 0.4614, 0.5514, 1.2048, 0.2102, 0.0526, 0.2986, 1.6055, 0.8224, 0.4445, 0.1717, 0.1221, 0.8452, 0.0563, 0.1124, 0.0281, 0.1122, 0.2262, 0.4874, 0.5639, 0.274, 0.0684, 0.0163, 0.0546, 0.1362, 0.3933, 0.2428, 0.2152, 0.4401, 0.7772, 0.791, 0.3369, 0.2839, 0.7752, 0.4058, 0.8584, 0.3479, 0.2969, 0.3938, 0.9694, 0.6339, 0.3335, 0.1426, 0.3077, 0.2594, 0.3521, 0.2106, 0.1401, 0.07, -0.0617, 0.3018, 0.0696, 0.0811, 0.2999, 0.1496, 0.1608, 0, 0","SHAPE-threshold":"0.324","SHAPE-max":"0.594","SHAPE-min":"0.054","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.054,\"max\":0.594,\"threshold\":0.324,\"peaks\":[-0.4546,1.2887,0.6689,0.6955,0.6254,0.3603,0.0109,0.6638,0.0324,-0.0033,0.0256,0.0323,0.0966,0.0429,0.4584,0.3923,0.3009,0.0475,0.0948,-0.0362,0.0947,0.1583,0.5608,0.4614,0.5514,1.2048,0.2102,0.0526,0.2986,1.6055,0.8224,0.4445,0.1717,0.1221,0.8452,0.0563,0.1124,0.0281,0.1122,0.2262,0.4874,0.5639,0.274,0.0684,0.0163,0.0546,0.1362,0.3933,0.2428,0.2152,0.4401,0.7772,0.791,0.3369,0.2839,0.7752,0.4058,0.8584,0.3479,0.2969,0.3938,0.9694,0.6339,0.3335,0.1426,0.3077,0.2594,0.3521,0.2106,0.1401,0.07,-0.0617,0.3018,0.0696,0.0811,0.2999,0.1496,0.1608,0,0]}]"},{"title":"GAAAAAH! - 2","id":"2873852","created":"1369107459","body":"Dot still great, lighter than 1 w\/ 25\/50 & 59\/66 mutated to AUVotes & Comments Welcome!","sequence":"GGAAAGCAGGAGCGAAAGCUCCACAGGCGAAAGCAGUGCGAAAGCACACUGAAGCAAGAGGAAACUCAGUAGAACUUCGGUUCUACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Jieux","uid":"48170","picture":"sites\/default\/files\/pictures\/picture-48170.png","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"18","au":"8","meltpoint":"107.00","energy":"-47.7","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAAAAH! - 1","id":"2873842","created":"1369107259","body":"Great dot & Heavy CGsVotes & Comments Welcome!","sequence":"GGAAAGCAGGAGCGAAAGCUCCACGGGCGAAAGCAGUGCGAAAGCACACCGAAGCAAGCGGAAACGCAGUACAACUUCGGUUGUACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Jieux","uid":"48170","picture":"sites\/default\/files\/pictures\/picture-48170.png","synthesis-score":"86","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"20","au":"6","meltpoint":"107.00","energy":"-50.3","has-fold-data":"0","SHAPE":"1, 0.1122, 0.4537, 1.1989, 0.6717, 0.5297, 0.2931, 0.437, 0.3479, 0.0579, 0.001, -0.0269, 0.0289, 0.2878, 0.0103, 0.4666, 0.4068, 0.2827, 0, 0.0565, 0, 0.0282, 0.0705, 0.4336, 0.056, 0.1397, 0.5803, 0.1796, 0.1516, 0.5743, 1.6305, 0.8929, 0.6954, 0.4149, 0.4276, 1.3181, 0.176, 0.1193, 0.0501, 0.0251, 0.1084, 0.7509, 0.2197, 0.5126, 0.1947, 0.1215, 0.0324, 0.2501, 0.5127, 0.1119, 0.1197, 0.4416, 1.2975, 1.1393, 0.4785, 0.5652, 0.6383, 1.0031, 0.1861, 0.1755, 0.3275, 0.1403, 0.9639, 0.7404, 0.2749, 0.05, 0.1475, 0.2278, 0.7169, 0.2691, 0.2681, 0.1852, 0.0822, 0.3034, 0.0204, 0.2035, 0.6545, 0.1255, 0.1403, 0, 0","SHAPE-threshold":"0.35","SHAPE-max":"0.641","SHAPE-min":"0.058","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.058,\"max\":0.641,\"threshold\":0.35,\"peaks\":[0.1122,0.4537,1.1989,0.6717,0.5297,0.2931,0.437,0.3479,0.0579,0.001,-0.0269,0.0289,0.2878,0.0103,0.4666,0.4068,0.2827,0,0.0565,0,0.0282,0.0705,0.4336,0.056,0.1397,0.5803,0.1796,0.1516,0.5743,1.6305,0.8929,0.6954,0.4149,0.4276,1.3181,0.176,0.1193,0.0501,0.0251,0.1084,0.7509,0.2197,0.5126,0.1947,0.1215,0.0324,0.2501,0.5127,0.1119,0.1197,0.4416,1.2975,1.1393,0.4785,0.5652,0.6383,1.0031,0.1861,0.1755,0.3275,0.1403,0.9639,0.7404,0.2749,0.05,0.1475,0.2278,0.7169,0.2691,0.2681,0.1852,0.0822,0.3034,0.0204,0.2035,0.6545,0.1255,0.1403,0,0]}]"},{"title":"Default title","id":"2873272","created":"1369092421","body":"No comment","sequence":"GGAAAGCGGAUAGGAAAUUAUCAGGCGCGAAAGUAGUAUGAAAGUAUAGUCAAGUGAUAGGAAACUGAUCUAUUCUUCGGAAUAGGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"SpaceFolder","uid":"10611","picture":"","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"8","gc":"8","au":"10","meltpoint":"87.00","energy":"-19.89","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAAH! Loop","id":"2873205","created":"1369091071","body":"No comment","sequence":"GGAAAGCGGUAUCGAAAGAUACAGGCGCGAAAGCAGUACGAAAGUACAGCCAAGCGAGUCGAAAGACAGCAUAACUUCGGUUAUGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"janetmason","uid":"56579","picture":"sites\/default\/files\/pictures\/picture-56579.png","synthesis-score":"89","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"16","au":"10","meltpoint":"97.00","energy":"-44.4","has-fold-data":"0","SHAPE":"1, 1.077, 0.8158, 1.4668, 0.5331, 0.6519, 0.3233, 0.1713, 0.1934, 0.1434, 0.0537, 0.0225, 0, -0.0355, 0.1071, 0.742, 0.2903, 0.158, 0.0263, 0.2623, 0.0556, 0.0293, -0.023, 0.3236, 1.1179, 0.272, 0.2085, 0.0559, 0.115, 0.1329, 0.6527, 0.4527, 0.2892, 0.1977, 0.1233, 0.3274, 0.0889, 0.0082, 0.0978, 0.0244, 0.2031, 0.7934, 0.248, 0.3582, 0.0596, 0.0498, 0.0476, 0.0872, 0.3368, 0.2044, -0.0894, 0.119, 0.2004, 0.4312, 0.2209, 0.1278, 0.6069, 1.171, 0.3906, 0.2009, 0.099, 0.3325, 0.6756, 0.5007, 0.3897, 0.3737, 0.4066, 0.1068, 0.4671, 0.106, 0.0953, 0.0951, -0.0145, 0.2798, 0.084, 0.5475, 1.1681, 0.2393, 0.1731, 0, 0","SHAPE-threshold":"0.266","SHAPE-max":"0.488","SHAPE-min":"0.044","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.044,\"max\":0.488,\"threshold\":0.266,\"peaks\":[1.077,0.8158,1.4668,0.5331,0.6519,0.3233,0.1713,0.1934,0.1434,0.0537,0.0225,0,-0.0355,0.1071,0.742,0.2903,0.158,0.0263,0.2623,0.0556,0.0293,-0.023,0.3236,1.1179,0.272,0.2085,0.0559,0.115,0.1329,0.6527,0.4527,0.2892,0.1977,0.1233,0.3274,0.0889,0.0082,0.0978,0.0244,0.2031,0.7934,0.248,0.3582,0.0596,0.0498,0.0476,0.0872,0.3368,0.2044,-0.0894,0.119,0.2004,0.4312,0.2209,0.1278,0.6069,1.171,0.3906,0.2009,0.099,0.3325,0.6756,0.5007,0.3897,0.3737,0.4066,0.1068,0.4671,0.106,0.0953,0.0951,-0.0145,0.2798,0.084,0.5475,1.1681,0.2393,0.1731,0,0]}]"},{"title":"GAAA loop 3","id":"2873159","created":"1369090302","body":"Alternate UA and GC closing pairs for hairpins.","sequence":"GGAAAGCAGUCGAGAAAUCGACAGCCGCGAAAGCAACUCGAAAGAGUAGGCAAGCAAGCAGAAAUGCAGCAGGUCUUCGGACCUGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"nihilnove","uid":"91837","picture":"sites\/default\/files\/pictures\/picture-91837.jpg","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"0","gc":"19","au":"7","meltpoint":"107.00","energy":"-47.5","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"1stPass_GAAA-Loop","id":"2872538","created":"1369078039","body":"No comment","sequence":"GGAAAGCAAUAUGGAAACAUAUAGACCGGAAACGAGUAUGAAAGUACAGUCAAGCAAGACGAAAGUCAAAUAUGCUUCGGCAUAUUAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"eternacac","uid":"55836","picture":"sites\/default\/files\/pictures\/picture-55836.gif","synthesis-score":null,"synthesis-round":"0","submitted-round":"1","gu":"1","gc":"12","au":"13","meltpoint":"87.00","energy":"-32.4","has-fold-data":"0","SHAPE":null,"SHAPE-threshold":null,"SHAPE-max":null,"SHAPE-min":null,"synthesis-data":null},{"title":"GAAA Loop 3z","id":"2872423","created":"1369076569","body":"No comment","sequence":"GGAAAGCAGUAGGGAAACCUACAGGCCGGAAACGAGCUGGAAACAGCAGCCAAGCAAGAGGAAACUCAGACUACCUUCGGGUAGUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Zanna","uid":"87216","picture":"sites\/default\/files\/pictures\/picture-87216.jpg","synthesis-score":"85","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"19","au":"7","meltpoint":"107.00","energy":"-49.8","has-fold-data":"0","SHAPE":"1, 0.3122, 1.1778, 1.428, 0.7732, 0.482, 0.3686, 0.2623, 0.2661, 0.1304, 0.1348, 0, 0.0048, 0.0519, 0.0565, 0.6425, 0.3453, 0.2929, 0.0037, 0, 0.0763, 0.0762, 0.2026, 0.1643, 0.589, 0.1251, 0.0528, 0.0057, 0.2982, 0.9817, 1.3931, 1.2116, 0.6155, 0.4261, 0.821, 0.8482, 0.3034, -0.0035, 0.045, 0.1347, 0.7993, 1.5214, 1.0414, 0.796, 0.4694, 0.5216, 0.1873, 0.2351, 0.2446, 0.642, 0.2348, 0.2651, 0.8833, 1.2218, 0.6098, 0.3918, 1.0793, 0.6718, 0.869, 0.4266, 0.2956, 0.3577, 1.1459, 0.784, 0.258, 0.1557, 0.1239, 0.2645, 0.3684, 0.1288, 0.035, 0.0175, 0.0586, 0.1107, 0.0348, 0.0008, 0.34, 0.0863, 0.2858, 0, 0","SHAPE-threshold":"0.397","SHAPE-max":"0.728","SHAPE-min":"0.066","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.066,\"max\":0.728,\"threshold\":0.397,\"peaks\":[0.3122,1.1778,1.428,0.7732,0.482,0.3686,0.2623,0.2661,0.1304,0.1348,0,0.0048,0.0519,0.0565,0.6425,0.3453,0.2929,0.0037,0,0.0763,0.0762,0.2026,0.1643,0.589,0.1251,0.0528,0.0057,0.2982,0.9817,1.3931,1.2116,0.6155,0.4261,0.821,0.8482,0.3034,-0.0035,0.045,0.1347,0.7993,1.5214,1.0414,0.796,0.4694,0.5216,0.1873,0.2351,0.2446,0.642,0.2348,0.2651,0.8833,1.2218,0.6098,0.3918,1.0793,0.6718,0.869,0.4266,0.2956,0.3577,1.1459,0.784,0.258,0.1557,0.1239,0.2645,0.3684,0.1288,0.035,0.0175,0.0586,0.1107,0.0348,0.0008,0.34,0.0863,0.2858,0,0]}]"},{"title":"GAAA Loop 2z","id":"2872419","created":"1369076516","body":"No comment","sequence":"GGAAAGCAGAUGGGAAACCAUCAGGCCGGAAACGAGCAGGAAACUGCAGCCAAGCAAGCGGAAACGCAGAGUACCUUCGGGUACUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Zanna","uid":"87216","picture":"sites\/default\/files\/pictures\/picture-87216.jpg","synthesis-score":"93","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"20","au":"6","meltpoint":"107.00","energy":"-51.1","has-fold-data":"0","SHAPE":"1, 0.708, 0.7335, 1.1768, 0.6047, 0.7158, 0.3601, 0.3418, 0.4304, 0.1566, 0.0495, 0.0165, 0.0989, 0.033, 0.1972, 0.7872, 0.3466, 0.4178, 0.0321, 0.0161, 0.0139, 0.039, 0.2145, 0.2653, 0.6008, 0.3247, 0.1176, 0.0845, 0.2583, 0.9568, 1.2771, 1.2119, 0.4502, 0.2249, 0.9119, 1.175, 0.1892, 0.1214, 0.1837, 0.2113, 0.5323, 1.2314, 0.7564, 0.5279, 0.1902, 0.1093, 0.0402, 0.0689, 0.2536, 0.5254, 0.1629, 0.2216, 0.6726, 1.0855, 0.5482, 0.6624, 0.9893, 1.084, 0.2315, 0.0854, 0.3391, 0.1929, 1.099, 0.8844, 0.3507, 0.1385, 0.0801, 0.3576, 0.586, 0.1796, 0.0631, 0.021, 0.0457, 0.1595, 0.0436, 0.2587, 0.5577, 0.2353, 0.3346, 0, 0","SHAPE-threshold":"0.388","SHAPE-max":"0.712","SHAPE-min":"0.065","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.065,\"max\":0.712,\"threshold\":0.388,\"peaks\":[0.708,0.7335,1.1768,0.6047,0.7158,0.3601,0.3418,0.4304,0.1566,0.0495,0.0165,0.0989,0.033,0.1972,0.7872,0.3466,0.4178,0.0321,0.0161,0.0139,0.039,0.2145,0.2653,0.6008,0.3247,0.1176,0.0845,0.2583,0.9568,1.2771,1.2119,0.4502,0.2249,0.9119,1.175,0.1892,0.1214,0.1837,0.2113,0.5323,1.2314,0.7564,0.5279,0.1902,0.1093,0.0402,0.0689,0.2536,0.5254,0.1629,0.2216,0.6726,1.0855,0.5482,0.6624,0.9893,1.084,0.2315,0.0854,0.3391,0.1929,1.099,0.8844,0.3507,0.1385,0.0801,0.3576,0.586,0.1796,0.0631,0.021,0.0457,0.1595,0.0436,0.2587,0.5577,0.2353,0.3346,0,0]}]"},{"title":"GAAA Loop 1z","id":"2872416","created":"1369076468","body":"No comment","sequence":"GGAAAGCAGAUGGGAAACCAUCAGCCCGGAAACGAGGAGGAAACUCCAGGCAAGCAAGCGGAAACGCAGAUCACGUUCGCGUGAUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Zanna","uid":"87216","picture":"sites\/default\/files\/pictures\/picture-87216.jpg","synthesis-score":"89","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"20","au":"6","meltpoint":"107.00","energy":"-47.8","has-fold-data":"0","SHAPE":"1, 0.5581, 0.6492, 1.3678, 0.5856, 0.646, 0.1084, 0.267, 0.3798, 0.0742, 0.1235, 0.0494, 0, 0.037, 0.2091, 0.5493, 0.6532, 0.4926, 0.0079, 0.0185, -0.0455, 0.0585, 0.0239, 0.4047, 0.2136, 0.0711, 0.0237, 0.071, 0.5238, 0.5782, 1.3344, 0.97, 0.664, 0.2867, 1.1016, 0.5535, 0.1296, 0.2582, 0.086, 0.1501, 0.3549, 0.9161, 0.5642, 0.5009, 0.1654, 0.0826, 0, 0.0275, 0.1305, 0.4448, 0.2322, 0.3861, 1.157, 0.8866, 0.9398, 0.7869, 0.7775, 1.4857, 0.2055, 0.2123, 0.3096, 0.2745, 0.8679, 0.8585, 0.4429, 0.155, 0.0272, 0.1893, 0.2584, 0.1049, 0.1048, 0.0349, 0.1568, 0.1391, 0.0521, 0.2682, 0.6602, 0.0413, 0.7397, 0, 0","SHAPE-threshold":"0.366","SHAPE-max":"0.67","SHAPE-min":"0.061","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.061,\"max\":0.67,\"threshold\":0.366,\"peaks\":[0.5581,0.6492,1.3678,0.5856,0.646,0.1084,0.267,0.3798,0.0742,0.1235,0.0494,0,0.037,0.2091,0.5493,0.6532,0.4926,0.0079,0.0185,-0.0455,0.0585,0.0239,0.4047,0.2136,0.0711,0.0237,0.071,0.5238,0.5782,1.3344,0.97,0.664,0.2867,1.1016,0.5535,0.1296,0.2582,0.086,0.1501,0.3549,0.9161,0.5642,0.5009,0.1654,0.0826,0,0.0275,0.1305,0.4448,0.2322,0.3861,1.157,0.8866,0.9398,0.7869,0.7775,1.4857,0.2055,0.2123,0.3096,0.2745,0.8679,0.8585,0.4429,0.155,0.0272,0.1893,0.2584,0.1049,0.1048,0.0349,0.1568,0.1391,0.0521,0.2682,0.6602,0.0413,0.7397,0,0]}]"},{"title":"Orraesti","id":"2872239","created":"1369073166","body":"For the record, I chose this sequence out of 31474 valid ones, and wasted 4069 simulations and 7211 seconds doing only that. *sigh*\r\r[1] -36.68\r.....((.(((((....))))).(((((....)).((((....)))).)))..))..(((....))).(((((((....))))))).....................\r[EDPF] 0.960\r","sequence":"GGAAACCACGCCGGAAACGGCGAGCCGCGAAAGCACUGAGAAAUCAGAGGCAGGGAACACGAAAGUGAAUUAUCCUUCGGGAUAAUAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"ViennaUCT","uid":"61031","picture":"sites\/default\/files\/pictures\/picture-61031.png","synthesis-score":"87","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"18","au":"8","meltpoint":"91.00","energy":"-36.68","has-fold-data":"0","SHAPE":"1, 0.0488, 0.3298, 0.5118, 1.1258, 0.3893, 0.0604, 0.1466, 0.24, 0.1198, 0, 0, 0, 0, 0.0199, 0.9649, 0.2781, 0.3509, 0, 0.175, -0.0939, 0.0583, 0.1164, 0.7487, 0.3439, -0.0938, 0.2855, 0.3409, 0.7868, 1.0158, 1.5894, 0.819, 0.2927, 0.2651, 0.2641, 0.4201, 0.2094, 0.0262, 0.0784, 0.2345, 0.3887, 0.6166, 0.5102, 0.2696, 0.2526, 0.0505, 0.0504, 0.2332, 0.6196, 0.6127, 0.2861, 0.1468, 0.1465, 0.1462, 0.15, 0.8639, 1.0406, 0.7489, 0.3261, 0.4164, 0.0462, 0.6416, 1.0757, 0.7925, 1.0072, 0.5588, 0.4742, 0.3332, 0.8841, 0.0844, 0.0843, 0.0842, 0.1681, 0.084, 0.0839, 0.1673, 0.4572, 0.083, 0.1243, 0, 0","SHAPE-threshold":"0.348","SHAPE-max":"0.638","SHAPE-min":"0.058","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.058,\"max\":0.638,\"threshold\":0.348,\"peaks\":[0.0488,0.3298,0.5118,1.1258,0.3893,0.0604,0.1466,0.24,0.1198,0,0,0,0,0.0199,0.9649,0.2781,0.3509,0,0.175,-0.0939,0.0583,0.1164,0.7487,0.3439,-0.0938,0.2855,0.3409,0.7868,1.0158,1.5894,0.819,0.2927,0.2651,0.2641,0.4201,0.2094,0.0262,0.0784,0.2345,0.3887,0.6166,0.5102,0.2696,0.2526,0.0505,0.0504,0.2332,0.6196,0.6127,0.2861,0.1468,0.1465,0.1462,0.15,0.8639,1.0406,0.7489,0.3261,0.4164,0.0462,0.6416,1.0757,0.7925,1.0072,0.5588,0.4742,0.3332,0.8841,0.0844,0.0843,0.0842,0.1681,0.084,0.0839,0.1673,0.4572,0.083,0.1243,0,0]}]"},{"title":"GAAA loop 1","id":"2872149","created":"1369070938","body":"Tried to keep the plots in good condition without too many GC pairs.","sequence":"GGAAACCAGUAGGGAAACCUACAGCGGCGAAAGCACAUGGAAACAUGACGCAAGGAAGUCGAAAGACAGCGUAGCUUCGGCUACGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"nihilnove","uid":"91837","picture":"sites\/default\/files\/pictures\/picture-91837.jpg","synthesis-score":"82","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"19","au":"7","meltpoint":"107.00","energy":"-48.2","has-fold-data":"0","SHAPE":"1, 0.1445, 0.6257, 1.1837, 0.8268, 0.4262, -0.1262, 0.3333, 0.601, 0.09, 0.06, 0.0268, 0.0299, -0.0331, 0.0416, 0.5191, 0.2954, 0.382, -0.0335, -0.0188, 0.0691, 0.117, 0.1415, 0.7791, 0.4587, 0.4275, 0.1422, 0.0852, 0.25, 0.7545, 1.1142, 0.4103, 0.4535, 0.1896, 0.3683, 0.2103, -0.0391, 0.1335, 0.08, 0.1331, 0.0619, 0.6526, 0.2011, 0.3264, 0.1421, 0.1296, 0.1036, 0.399, 0.691, 0.7395, 0.159, 0.172, 0.5342, 0.5547, 0.4533, 0.8795, 0.7506, 1.3208, 0.2419, 0.1165, 0.1395, 0.2548, 0.7743, 0.3598, 0.3236, 0.4393, 0.7117, 0.1606, 0.4281, 0.216, 0.0796, 0.1305, 0.1519, 0.3181, 0.1932, 0.4057, 0.7304, 0.2516, 0.2761, 0, 0","SHAPE-threshold":"0.326","SHAPE-max":"0.597","SHAPE-min":"0.054","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.054,\"max\":0.597,\"threshold\":0.326,\"peaks\":[0.1445,0.6257,1.1837,0.8268,0.4262,-0.1262,0.3333,0.601,0.09,0.06,0.0268,0.0299,-0.0331,0.0416,0.5191,0.2954,0.382,-0.0335,-0.0188,0.0691,0.117,0.1415,0.7791,0.4587,0.4275,0.1422,0.0852,0.25,0.7545,1.1142,0.4103,0.4535,0.1896,0.3683,0.2103,-0.0391,0.1335,0.08,0.1331,0.0619,0.6526,0.2011,0.3264,0.1421,0.1296,0.1036,0.399,0.691,0.7395,0.159,0.172,0.5342,0.5547,0.4533,0.8795,0.7506,1.3208,0.2419,0.1165,0.1395,0.2548,0.7743,0.3598,0.3236,0.4393,0.7117,0.1606,0.4281,0.216,0.0796,0.1305,0.1519,0.3181,0.1932,0.4057,0.7304,0.2516,0.2761,0,0]}]"},{"title":"wisdave GAAA","id":"2871893","created":"1369062965","body":"No comment","sequence":"GGAAAGCAGUAUGGAAACAUACAGUCGGGAAACCAGAUGGAAACAUCAGACAAGCAAGUGGAAACACAGUAUAUCUUCGGAUAUACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"wisdave","uid":"4167","picture":"","synthesis-score":"86","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"14","au":"12","meltpoint":"97.00","energy":"-40.7","has-fold-data":"0","SHAPE":"1, 0.2877, 0.724, 0.8456, 0.6494, 0.726, 0.4155, 0.1953, 0.9491, 0.108, 0.0476, 0.0118, 0.0478, 0.1432, 0.3642, 0.5266, 0.3354, 0.22, 0.066, 0.1163, 0.1011, 0.1261, 0.0772, 0.8081, 0.8516, 0.1663, 0.0718, 0.1098, 0.1777, 0.95, 0.9912, 0.6237, 0.445, 0.1953, 1.037, 0.6272, 0.9252, 0.5411, 0.1827, 0.1418, 0.2624, 0.8182, 0.4205, 0.2766, 0.2217, 0.1569, 0.1565, 0.3311, 0.3586, 0.5318, 0.6007, 0.3266, 1.1715, 1.4856, 0.4714, 0.4602, 0.818, 1.2292, 0.5855, 0.1953, 0.2452, 0.2537, 0.9313, 0.4486, 0.3498, 0.1894, 0.2867, 0.1728, 0.8538, 0.2512, 0.1267, 0.0646, 0.1451, 0.1202, 0.0161, 0.0467, 0.2703, 0.1595, 0.1909, 0, 0","SHAPE-threshold":"0.398","SHAPE-max":"0.729","SHAPE-min":"0.066","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.066,\"max\":0.729,\"threshold\":0.398,\"peaks\":[0.2877,0.724,0.8456,0.6494,0.726,0.4155,0.1953,0.9491,0.108,0.0476,0.0118,0.0478,0.1432,0.3642,0.5266,0.3354,0.22,0.066,0.1163,0.1011,0.1261,0.0772,0.8081,0.8516,0.1663,0.0718,0.1098,0.1777,0.95,0.9912,0.6237,0.445,0.1953,1.037,0.6272,0.9252,0.5411,0.1827,0.1418,0.2624,0.8182,0.4205,0.2766,0.2217,0.1569,0.1565,0.3311,0.3586,0.5318,0.6007,0.3266,1.1715,1.4856,0.4714,0.4602,0.818,1.2292,0.5855,0.1953,0.2452,0.2537,0.9313,0.4486,0.3498,0.1894,0.2867,0.1728,0.8538,0.2512,0.1267,0.0646,0.1451,0.1202,0.0161,0.0467,0.2703,0.1595,0.1909,0,0]}]"}]},"memcache":true}