{"data":{"lab":{"puzzle_nid":"2857430","secstruct":"((.(((((....))))).(((((....)).((((....)))).)))..))..(((....))).(((((((....))))))).","rna_type":"single","object":null,"nid":"2857430","created":"1368648880","title":"The GAAA loop","body":"The GAAA tetraloop is one of the most common tetraloop sequences found in nature. However, in the lab the SHAPE data shows that in a large percentage of cases, the closing base nucleotides are not measured as being tightly bound. Perusing the CoSSMos database (http:\/\/cossmos.slu.edu\/), it seems that the nucleotides in the loop can take on quite varied 3D arrangements. Some of these have the closing base pairs appear to have strong Watson-Crick bindings, but many do not. The hope for this lab is that we can discover what hairpin base sequences score well in the lab when the loop sequence is GAAA.","uid":"57675","field_puzzle_synthesis_winner_nid":"2389702","exp_phase":"1","exp_phase_start":null,"exp_phase_end":null,"last_round":"0","date":"05\/22\/2013 11:59 PM","num_synth":"40","affiliation":null,"selection":"user_vote","pending":null,"voters":null,"cover_image":null,"round":1,"synthesized_solutions":[{"title":"GAAA Loop 2z","id":"2872419","created":"1369076516","body":"No comment","sequence":"GGAAAGCAGAUGGGAAACCAUCAGGCCGGAAACGAGCAGGAAACUGCAGCCAAGCAAGCGGAAACGCAGAGUACCUUCGGGUACUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Zanna","uid":"87216","picture":"sites\/default\/files\/pictures\/picture-87216.jpg","synthesis-score":"93","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"20","au":"6","meltpoint":"107.00","energy":"-51.1","has-fold-data":"0","SHAPE":"1, 0.708, 0.7335, 1.1768, 0.6047, 0.7158, 0.3601, 0.3418, 0.4304, 0.1566, 0.0495, 0.0165, 0.0989, 0.033, 0.1972, 0.7872, 0.3466, 0.4178, 0.0321, 0.0161, 0.0139, 0.039, 0.2145, 0.2653, 0.6008, 0.3247, 0.1176, 0.0845, 0.2583, 0.9568, 1.2771, 1.2119, 0.4502, 0.2249, 0.9119, 1.175, 0.1892, 0.1214, 0.1837, 0.2113, 0.5323, 1.2314, 0.7564, 0.5279, 0.1902, 0.1093, 0.0402, 0.0689, 0.2536, 0.5254, 0.1629, 0.2216, 0.6726, 1.0855, 0.5482, 0.6624, 0.9893, 1.084, 0.2315, 0.0854, 0.3391, 0.1929, 1.099, 0.8844, 0.3507, 0.1385, 0.0801, 0.3576, 0.586, 0.1796, 0.0631, 0.021, 0.0457, 0.1595, 0.0436, 0.2587, 0.5577, 0.2353, 0.3346, 0, 0","SHAPE-threshold":"0.388","SHAPE-max":"0.712","SHAPE-min":"0.065","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.065,\"max\":0.712,\"threshold\":0.388,\"peaks\":[0.708,0.7335,1.1768,0.6047,0.7158,0.3601,0.3418,0.4304,0.1566,0.0495,0.0165,0.0989,0.033,0.1972,0.7872,0.3466,0.4178,0.0321,0.0161,0.0139,0.039,0.2145,0.2653,0.6008,0.3247,0.1176,0.0845,0.2583,0.9568,1.2771,1.2119,0.4502,0.2249,0.9119,1.175,0.1892,0.1214,0.1837,0.2113,0.5323,1.2314,0.7564,0.5279,0.1902,0.1093,0.0402,0.0689,0.2536,0.5254,0.1629,0.2216,0.6726,1.0855,0.5482,0.6624,0.9893,1.084,0.2315,0.0854,0.3391,0.1929,1.099,0.8844,0.3507,0.1385,0.0801,0.3576,0.586,0.1796,0.0631,0.021,0.0457,0.1595,0.0436,0.2587,0.5577,0.2353,0.3346,0,0]}]"},{"title":"G3AAA - Brourd - Lab 'The GAAA loop' R1 - Sub 3 (Extra G-C pairs)","id":"2874172","created":"1369119898","body":"No comment","sequence":"GGAAAGCAGAUGGGAAACCAUCAGGCCCGAAAGGUGAGCGAAAGCUCUGCCAAGCAAGCCGAAAGGCACUACGACUUCGGUCGUAGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Brourd","uid":"24263","picture":"sites\/default\/files\/pictures\/picture-24263.png","synthesis-score":"91","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"20","au":"6","meltpoint":"107.00","energy":"-50.1","has-fold-data":"0","SHAPE":"1, 0.8606, 0.4897, 1.0637, 1.0238, 0.7275, 0.1079, 0.1077, 0.4183, 0.0778, 0.0367, 0.0621, 0, 0.0931, 0.1193, 0.4815, 0.4428, 0.4853, 0.0529, 0.0831, 0.0298, 0.1132, 0.1252, 0.1719, 0.2563, 0.1467, 0.0387, 0.0819, 0.3647, 0.8225, 1.0231, 0.7628, 0.3535, 0.1444, 0.2326, 0.0493, 0.0563, -0.0559, 0.0422, 0.073, 0.0267, 0.4138, 0.3779, 0.197, 0.0414, 0.0162, 0.0414, 0.1239, 0.5425, 0.6344, 0.0854, 0.1185, 0.5792, 0.8677, 0.4913, 0.7236, 0.7464, 0.8596, 0.164, 0.0755, 0.1256, 0.2504, 0.5955, 0.2843, 0.1726, 0.0862, 0.0984, 0.0856, 0.1583, 0.0729, 0.0728, 0.1462, 0.0232, 0.1687, 0.1091, 0.2039, 0.5599, 0.1413, 0.3197, 0, 0","SHAPE-threshold":"0.257","SHAPE-max":"0.47","SHAPE-min":"0.043","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.043,\"max\":0.47,\"threshold\":0.257,\"peaks\":[0.8606,0.4897,1.0637,1.0238,0.7275,0.1079,0.1077,0.4183,0.0778,0.0367,0.0621,0,0.0931,0.1193,0.4815,0.4428,0.4853,0.0529,0.0831,0.0298,0.1132,0.1252,0.1719,0.2563,0.1467,0.0387,0.0819,0.3647,0.8225,1.0231,0.7628,0.3535,0.1444,0.2326,0.0493,0.0563,-0.0559,0.0422,0.073,0.0267,0.4138,0.3779,0.197,0.0414,0.0162,0.0414,0.1239,0.5425,0.6344,0.0854,0.1185,0.5792,0.8677,0.4913,0.7236,0.7464,0.8596,0.164,0.0755,0.1256,0.2504,0.5955,0.2843,0.1726,0.0862,0.0984,0.0856,0.1583,0.0729,0.0728,0.1462,0.0232,0.1687,0.1091,0.2039,0.5599,0.1413,0.3197,0,0]}]"},{"title":"GAAA loop V.2","id":"2885745","created":"1369354288","body":"A mix of GC and UA closing pairs.","sequence":"GGAAAGCAGGAUAGAAAUAUCCAGGCGCGAAAGCAGAUAGAAAUAUCAGCCAAGCAAGUGGAAACACAGUAAUUCUUCGGAAUUACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"nihilnove","uid":"91837","picture":"sites\/default\/files\/pictures\/picture-91837.jpg","synthesis-score":"91","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"14","au":"12","meltpoint":"87.00","energy":"-38.1","has-fold-data":"0","SHAPE":"1, 0.6198, 0.6251, 1.2578, 0.8221, 0.5297, 0.0616, 0.1052, 0.1965, 0.1324, 0.122, 0.0329, 0.1823, 0.0607, 0.2721, 0.9253, 0.298, 0.6184, 0.2933, 0.0391, 0.0392, 0.0293, 0.039, 0.3005, 0.644, 0.1822, 0.2294, 0.0573, 0.0954, 0.1807, 0.6251, 0.3627, 0.4739, 0.0835, 0.0531, 0.1941, -0.0053, 0.0802, 0.0828, 0.0523, 0.171, 0.6554, 0.175, 0.5585, 0.1611, 0.0562, 0, 0.1071, 0.7157, 0.1851, 0.0264, 0.0528, 0.195, 0.5735, 0.1301, 0.4591, 0.5572, 1.0769, 0.5752, 0.1995, 0.2485, 0.223, 0.5323, 0.5002, 0.2311, 0.2574, 0.364, 0.1714, 0.8166, 0.1784, 0.0136, 0.0939, 0.0269, 0.2001, 0, 0.1863, 0.6353, 0.0691, 0.2068, 0, 0","SHAPE-threshold":"0.26","SHAPE-max":"0.477","SHAPE-min":"0.043","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.043,\"max\":0.477,\"threshold\":0.26,\"peaks\":[0.6198,0.6251,1.2578,0.8221,0.5297,0.0616,0.1052,0.1965,0.1324,0.122,0.0329,0.1823,0.0607,0.2721,0.9253,0.298,0.6184,0.2933,0.0391,0.0392,0.0293,0.039,0.3005,0.644,0.1822,0.2294,0.0573,0.0954,0.1807,0.6251,0.3627,0.4739,0.0835,0.0531,0.1941,-0.0053,0.0802,0.0828,0.0523,0.171,0.6554,0.175,0.5585,0.1611,0.0562,0,0.1071,0.7157,0.1851,0.0264,0.0528,0.195,0.5735,0.1301,0.4591,0.5572,1.0769,0.5752,0.1995,0.2485,0.223,0.5323,0.5002,0.2311,0.2574,0.364,0.1714,0.8166,0.1784,0.0136,0.0939,0.0269,0.2001,0,0.1863,0.6353,0.0691,0.2068,0,0]}]"},{"title":"Which will hold and which will fall apart?","id":"2902540","created":"1369703811","body":"A variety of solutions in one design. GCs and 0.2 in the short stacks. More risk in the longer: an AU and a GU with supporting GCs.","sequence":"GGAAAGCAGUAGAGAAAUCUACAGACGGGAAACCAGUGUGAAAGCACAGUCAAGCAAGCGGAAACGCAGGUCCGCUUCGGCGGACCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"wateronthemoon","uid":"57743","picture":"sites\/default\/files\/pictures\/picture-57743.jpg","synthesis-score":"91","synthesis-round":"1","submitted-round":"1","gu":"1","gc":"19","au":"6","meltpoint":"107.00","energy":"-47.4","has-fold-data":"0","SHAPE":"1, 0.1518, 0.8646, 0.7132, 0.9146, 0.5816, 0.1605, 0.3777, 0.3825, 0.1198, 0.1196, 0.0631, 0, 0.2115, 0.2076, 0.908, 0.4222, 0.5644, 0.0865, 0.0576, 0.0302, 0.1149, 0.1577, 0.5688, 0.8987, 0.2233, 0.1256, 0.278, 0.3412, 0.7445, 0.953, 0.8529, 0.7609, 0.1578, 0.3402, 0.9129, 0.1286, 0.1024, 0.3577, 0.3053, 0.3796, 0.8872, 0.3296, 0.6731, 0.3965, 0.1025, 0.1707, 0.28, 0.7793, 0.6245, 0.1959, 0.2775, 0.8474, 1.0421, 1.0365, 0.4478, 1.0155, 0.9891, 0.3895, 0.108, 0.3226, 0.1502, 0.7225, 0.7329, 0.449, 0.1667, 0.3318, 0.3166, 0.5658, 0.2109, 0.0061, 0.0611, -0.0347, 0.1134, 0.0811, 0.0608, 0.5431, 0.2106, 0.1701, 0, 0","SHAPE-threshold":"0.389","SHAPE-max":"0.714","SHAPE-min":"0.065","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.065,\"max\":0.714,\"threshold\":0.389,\"peaks\":[0.1518,0.8646,0.7132,0.9146,0.5816,0.1605,0.3777,0.3825,0.1198,0.1196,0.0631,0,0.2115,0.2076,0.908,0.4222,0.5644,0.0865,0.0576,0.0302,0.1149,0.1577,0.5688,0.8987,0.2233,0.1256,0.278,0.3412,0.7445,0.953,0.8529,0.7609,0.1578,0.3402,0.9129,0.1286,0.1024,0.3577,0.3053,0.3796,0.8872,0.3296,0.6731,0.3965,0.1025,0.1707,0.28,0.7793,0.6245,0.1959,0.2775,0.8474,1.0421,1.0365,0.4478,1.0155,0.9891,0.3895,0.108,0.3226,0.1502,0.7225,0.7329,0.449,0.1667,0.3318,0.3166,0.5658,0.2109,0.0061,0.0611,-0.0347,0.1134,0.0811,0.0608,0.5431,0.2106,0.1701,0,0]}]"},{"title":"Scale","id":"2887512","created":"1369410214","body":"no comment","sequence":"GGAAACCAGAGACGAAAGUCUCAGCCGCGAAAGCAGCACGAAAGUGCAGGCAAGGAAGUCGAAAGACAGAGACACUUCGGUGUCUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"hoglahoo","uid":"36921","picture":"sites\/default\/files\/pictures\/picture-36921.gif","synthesis-score":"90","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"19","au":"7","meltpoint":"107.00","energy":"-50.5","has-fold-data":"0","SHAPE":"1, 0.3973, 0.2793, 1.0881, 0.8463, 1.025, 0.1966, 0.3175, 0.5399, 0, 0, 0.0792, 0.0668, 0.0456, 0.0667, 0.7261, 0.1647, 0.3115, 0.1146, 0.0327, 0.0109, -0.0218, -0.0217, 0.6153, 0.2099, 0.0263, 0.2028, 0.2562, 0.4455, 0.8802, 1.2725, 0.8989, 1.2525, 0.3377, 0.2277, 0.6507, 0.205, 0.0878, 0, -0.094, 0.4838, 0.7317, 0.4369, 0.4108, 0.0849, 0.0848, 0.0283, 0.1691, 0.1989, 0.4281, 0.1208, 0.3329, 0.4868, 0.5112, 0.4889, 0.9364, 1.1178, 1.5297, 0.356, 0.2297, 0.1528, 0.2411, 1.1075, 0.5206, 0.1892, 0.1881, 0.3669, 0.1465, 0.4126, 0.0193, -0.0049, 0.0242, -0.0291, 0.0726, 0.1689, 0.0964, 0.4198, 0.1433, 0.4508, 0, 0","SHAPE-threshold":"0.34","SHAPE-max":"0.623","SHAPE-min":"0.057","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.057,\"max\":0.623,\"threshold\":0.34,\"peaks\":[0.3973,0.2793,1.0881,0.8463,1.025,0.1966,0.3175,0.5399,0,0,0.0792,0.0668,0.0456,0.0667,0.7261,0.1647,0.3115,0.1146,0.0327,0.0109,-0.0218,-0.0217,0.6153,0.2099,0.0263,0.2028,0.2562,0.4455,0.8802,1.2725,0.8989,1.2525,0.3377,0.2277,0.6507,0.205,0.0878,0,-0.094,0.4838,0.7317,0.4369,0.4108,0.0849,0.0848,0.0283,0.1691,0.1989,0.4281,0.1208,0.3329,0.4868,0.5112,0.4889,0.9364,1.1178,1.5297,0.356,0.2297,0.1528,0.2411,1.1075,0.5206,0.1892,0.1881,0.3669,0.1465,0.4126,0.0193,-0.0049,0.0242,-0.0291,0.0726,0.1689,0.0964,0.4198,0.1433,0.4508,0,0]}]"},{"title":"GAAA Loop 1z","id":"2872416","created":"1369076468","body":"No comment","sequence":"GGAAAGCAGAUGGGAAACCAUCAGCCCGGAAACGAGGAGGAAACUCCAGGCAAGCAAGCGGAAACGCAGAUCACGUUCGCGUGAUCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Zanna","uid":"87216","picture":"sites\/default\/files\/pictures\/picture-87216.jpg","synthesis-score":"89","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"20","au":"6","meltpoint":"107.00","energy":"-47.8","has-fold-data":"0","SHAPE":"1, 0.5581, 0.6492, 1.3678, 0.5856, 0.646, 0.1084, 0.267, 0.3798, 0.0742, 0.1235, 0.0494, 0, 0.037, 0.2091, 0.5493, 0.6532, 0.4926, 0.0079, 0.0185, -0.0455, 0.0585, 0.0239, 0.4047, 0.2136, 0.0711, 0.0237, 0.071, 0.5238, 0.5782, 1.3344, 0.97, 0.664, 0.2867, 1.1016, 0.5535, 0.1296, 0.2582, 0.086, 0.1501, 0.3549, 0.9161, 0.5642, 0.5009, 0.1654, 0.0826, 0, 0.0275, 0.1305, 0.4448, 0.2322, 0.3861, 1.157, 0.8866, 0.9398, 0.7869, 0.7775, 1.4857, 0.2055, 0.2123, 0.3096, 0.2745, 0.8679, 0.8585, 0.4429, 0.155, 0.0272, 0.1893, 0.2584, 0.1049, 0.1048, 0.0349, 0.1568, 0.1391, 0.0521, 0.2682, 0.6602, 0.0413, 0.7397, 0, 0","SHAPE-threshold":"0.366","SHAPE-max":"0.67","SHAPE-min":"0.061","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.061,\"max\":0.67,\"threshold\":0.366,\"peaks\":[0.5581,0.6492,1.3678,0.5856,0.646,0.1084,0.267,0.3798,0.0742,0.1235,0.0494,0,0.037,0.2091,0.5493,0.6532,0.4926,0.0079,0.0185,-0.0455,0.0585,0.0239,0.4047,0.2136,0.0711,0.0237,0.071,0.5238,0.5782,1.3344,0.97,0.664,0.2867,1.1016,0.5535,0.1296,0.2582,0.086,0.1501,0.3549,0.9161,0.5642,0.5009,0.1654,0.0826,0,0.0275,0.1305,0.4448,0.2322,0.3861,1.157,0.8866,0.9398,0.7869,0.7775,1.4857,0.2055,0.2123,0.3096,0.2745,0.8679,0.8585,0.4429,0.155,0.0272,0.1893,0.2584,0.1049,0.1048,0.0349,0.1568,0.1391,0.0521,0.2682,0.6602,0.0413,0.7397,0,0]}]"},{"title":"GAAAH! Loop","id":"2873205","created":"1369091071","body":"No comment","sequence":"GGAAAGCGGUAUCGAAAGAUACAGGCGCGAAAGCAGUACGAAAGUACAGCCAAGCGAGUCGAAAGACAGCAUAACUUCGGUUAUGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"janetmason","uid":"56579","picture":"sites\/default\/files\/pictures\/picture-56579.png","synthesis-score":"89","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"16","au":"10","meltpoint":"97.00","energy":"-44.4","has-fold-data":"0","SHAPE":"1, 1.077, 0.8158, 1.4668, 0.5331, 0.6519, 0.3233, 0.1713, 0.1934, 0.1434, 0.0537, 0.0225, 0, -0.0355, 0.1071, 0.742, 0.2903, 0.158, 0.0263, 0.2623, 0.0556, 0.0293, -0.023, 0.3236, 1.1179, 0.272, 0.2085, 0.0559, 0.115, 0.1329, 0.6527, 0.4527, 0.2892, 0.1977, 0.1233, 0.3274, 0.0889, 0.0082, 0.0978, 0.0244, 0.2031, 0.7934, 0.248, 0.3582, 0.0596, 0.0498, 0.0476, 0.0872, 0.3368, 0.2044, -0.0894, 0.119, 0.2004, 0.4312, 0.2209, 0.1278, 0.6069, 1.171, 0.3906, 0.2009, 0.099, 0.3325, 0.6756, 0.5007, 0.3897, 0.3737, 0.4066, 0.1068, 0.4671, 0.106, 0.0953, 0.0951, -0.0145, 0.2798, 0.084, 0.5475, 1.1681, 0.2393, 0.1731, 0, 0","SHAPE-threshold":"0.266","SHAPE-max":"0.488","SHAPE-min":"0.044","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.044,\"max\":0.488,\"threshold\":0.266,\"peaks\":[1.077,0.8158,1.4668,0.5331,0.6519,0.3233,0.1713,0.1934,0.1434,0.0537,0.0225,0,-0.0355,0.1071,0.742,0.2903,0.158,0.0263,0.2623,0.0556,0.0293,-0.023,0.3236,1.1179,0.272,0.2085,0.0559,0.115,0.1329,0.6527,0.4527,0.2892,0.1977,0.1233,0.3274,0.0889,0.0082,0.0978,0.0244,0.2031,0.7934,0.248,0.3582,0.0596,0.0498,0.0476,0.0872,0.3368,0.2044,-0.0894,0.119,0.2004,0.4312,0.2209,0.1278,0.6069,1.171,0.3906,0.2009,0.099,0.3325,0.6756,0.5007,0.3897,0.3737,0.4066,0.1068,0.4671,0.106,0.0953,0.0951,-0.0145,0.2798,0.084,0.5475,1.1681,0.2393,0.1731,0,0]}]"},{"title":"G1A - Brourd - Lab 'The GAAA loop' R1 - Sub 1 (GGAAAC closing pairs)","id":"2874165","created":"1369119682","body":"No comment","sequence":"GGAAAGCAGACUGGAAACAGUCAGACGGGAAACCAGCUGGAAACAGCAGUCAAGCAAGAGGAAACUCAGUCAGUCUUCGGACUGACAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Brourd","uid":"24263","picture":"sites\/default\/files\/pictures\/picture-24263.png","synthesis-score":"89","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"18","au":"8","meltpoint":"107.00","energy":"-49","has-fold-data":"0","SHAPE":"1, 0.1114, 0.5748, 0.9822, 0.7543, 0.7518, 0.3135, 0.2683, 0.3418, 0.2163, 0.0638, -0.0144, -0.039, 0.0141, 0.5053, 0.8832, 0.1984, 0.3936, 0.1439, 0.1845, 0.4482, 0.225, 0.1485, 0.5395, 0.764, 0.6496, 0.333, 0.127, 0.2402, 0.776, 1.066, 0.7945, 0.8054, 0.0705, 0.3127, 0.4456, 0.08, 0.0729, 0.0182, 0.0342, 0.5465, 0.9418, 0.5709, 0.3827, 0.1366, 0.1362, 0.3477, 0.2051, 0.3993, 0.4823, 0.1847, 0.2751, 0.8859, 0.9571, 0.4531, 0.4229, 0.9462, 0.6258, 0.9732, 0.3521, 0.4426, 0.4009, 1.2269, 0.7485, 0.3706, 0.1973, 0.2659, 0.2942, 0.4007, 0.2968, 0.1307, 0.0056, 0.0346, 0.2237, 0.1009, 0.192, 0.6309, 0.1703, 0.2405, 0, 0","SHAPE-threshold":"0.39","SHAPE-max":"0.714","SHAPE-min":"0.065","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.065,\"max\":0.714,\"threshold\":0.39,\"peaks\":[0.1114,0.5748,0.9822,0.7543,0.7518,0.3135,0.2683,0.3418,0.2163,0.0638,-0.0144,-0.039,0.0141,0.5053,0.8832,0.1984,0.3936,0.1439,0.1845,0.4482,0.225,0.1485,0.5395,0.764,0.6496,0.333,0.127,0.2402,0.776,1.066,0.7945,0.8054,0.0705,0.3127,0.4456,0.08,0.0729,0.0182,0.0342,0.5465,0.9418,0.5709,0.3827,0.1366,0.1362,0.3477,0.2051,0.3993,0.4823,0.1847,0.2751,0.8859,0.9571,0.4531,0.4229,0.9462,0.6258,0.9732,0.3521,0.4426,0.4009,1.2269,0.7485,0.3706,0.1973,0.2659,0.2942,0.4007,0.2968,0.1307,0.0056,0.0346,0.2237,0.1009,0.192,0.6309,0.1703,0.2405,0,0]}]"},{"title":"kcab - GAAA loop 3","id":"2877144","created":"1369188049","body":"Flipped some GCs and added a GU pair. -43.3 kcal.","sequence":"GGAAAGCAGUUGCGAAAGCGACAGACGGGAAACCAGUAGGAAACUACAGUCAAGCAACGAGAAAUCGACAGAGACUUCGGUCUCUGAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"kcabral28","uid":"64124","picture":"sites\/default\/files\/pictures\/picture-64124.jpg","synthesis-score":"89","synthesis-round":"1","submitted-round":"1","gu":"1","gc":"17","au":"8","meltpoint":"97.00","energy":"-43.3","has-fold-data":"0","SHAPE":"1, 0.5199, 0.8261, 0.851, 0.6017, 0.67, 0.4332, 0.5026, 1.2584, 0.2094, 0.1393, -0.0063, 0.0282, 0.1315, 0.5339, 0.8988, 0.6651, 0.7254, 0.3081, 0.685, 0.2793, 0.1376, 0.2859, 0.4334, 0.9902, 0.6525, 0.2716, 0.1065, 0.2383, 0.4403, 0.8017, 0.7394, 0.463, 0.1595, 0.5029, 1.0354, 0.3956, 0.1534, 0.1192, 0.1686, 0.2824, 0.8796, 0.7063, 0.3682, 0.2513, 0.1822, 0.2186, 0.1149, 0.73, 0.3772, 0.0703, 0.1989, 0.6691, 1.8018, 0.213, 0.1238, 0.3858, 0.2588, 0.1631, 0.4085, 0.7752, 1.0202, 1.6191, 0.6489, 0.6341, 0.176, 0.074, 0.275, 0.3425, 0.1239, 0.061, 0.0495, -0.0018, 0.1716, 0.0123, 0.1353, 0.3659, 0.0733, 0.218, 0, 0","SHAPE-threshold":"0.415","SHAPE-max":"0.762","SHAPE-min":"0.069","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.069,\"max\":0.762,\"threshold\":0.415,\"peaks\":[0.5199,0.8261,0.851,0.6017,0.67,0.4332,0.5026,1.2584,0.2094,0.1393,-0.0063,0.0282,0.1315,0.5339,0.8988,0.6651,0.7254,0.3081,0.685,0.2793,0.1376,0.2859,0.4334,0.9902,0.6525,0.2716,0.1065,0.2383,0.4403,0.8017,0.7394,0.463,0.1595,0.5029,1.0354,0.3956,0.1534,0.1192,0.1686,0.2824,0.8796,0.7063,0.3682,0.2513,0.1822,0.2186,0.1149,0.73,0.3772,0.0703,0.1989,0.6691,1.8018,0.213,0.1238,0.3858,0.2588,0.1631,0.4085,0.7752,1.0202,1.6191,0.6489,0.6341,0.176,0.074,0.275,0.3425,0.1239,0.061,0.0495,-0.0018,0.1716,0.0123,0.1353,0.3659,0.0733,0.218,0,0]}]"},{"title":"MOD of Ruler by Hoglahoo","id":"2889883","created":"1369446838","body":"similar to my 0.2\/0.4 loops design. Flipped GC's on the shorter stacks to get the 0.2 kcal loops ","sequence":"GGAAAGCAGAGACGAAAGUCUCAGCCGGGAAACCAGCACGAAAGUGCAGGCAAGCAAGAGGAAACUCAGCCACACUUCGGUGUGGCAAAAGAAACAACAACAACAAC","puznid":"2857430","name":"Hyphema","uid":"58224","picture":"sites\/default\/files\/pictures\/picture-58224.jpg","synthesis-score":"89","synthesis-round":"1","submitted-round":"1","gu":"0","gc":"20","au":"6","meltpoint":"107.00","energy":"-53","has-fold-data":"0","SHAPE":"1, 0.2105, 0.9178, 0.7689, 1.029, 0.767, 0.3746, 0.2695, 0.2242, 0.163, 0.0753, 0.0547, 0.0547, 0.0205, 0.2228, 0.3835, 0.504, 0.3411, 0.1402, 0.0569, 0, 0.0799, 0.0798, 0.3177, 0.1585, 0.0396, 0, 0.2369, 0.1689, 1.015, 1.2172, 1.0092, 0.6044, 0.1479, 0.3313, 0.5117, 0.2549, -0.0626, 0.0364, 0.0182, 0.0505, 0.6683, 0.2982, 0.4622, 0.1503, 0.0085, 0.0472, 0.0825, 0.1529, 0.0434, 0.2107, 0.4884, 0.7252, 1.3553, 0.9034, 0.5808, 0.7716, 0.7794, 0.7724, 0.4466, 0.3502, 0.5039, 1.0837, 0.7646, 0.1832, 0.1815, 0.2426, 0.1211, 0.2079, 0.1186, -0.0333, 0.0882, 0.0563, 0.1374, 0.1185, 0.322, 0.5847, 0.2301, 0.5776, 0, 0","SHAPE-threshold":"0.334","SHAPE-max":"0.613","SHAPE-min":"0.056","synthesis-data":"[{\"start_index\":1,\"target_index\":0,\"reactive\":\"SHAPE\",\"min\":0.056,\"max\":0.613,\"threshold\":0.334,\"peaks\":[0.2105,0.9178,0.7689,1.029,0.767,0.3746,0.2695,0.2242,0.163,0.0753,0.0547,0.0547,0.0205,0.2228,0.3835,0.504,0.3411,0.1402,0.0569,0,0.0799,0.0798,0.3177,0.1585,0.0396,0,0.2369,0.1689,1.015,1.2172,1.0092,0.6044,0.1479,0.3313,0.5117,0.2549,-0.0626,0.0364,0.0182,0.0505,0.6683,0.2982,0.4622,0.1503,0.0085,0.0472,0.0825,0.1529,0.0434,0.2107,0.4884,0.7252,1.3553,0.9034,0.5808,0.7716,0.7794,0.7724,0.4466,0.3502,0.5039,1.0837,0.7646,0.1832,0.1815,0.2426,0.1211,0.2079,0.1186,-0.0333,0.0882,0.0563,0.1374,0.1185,0.322,0.5847,0.2301,0.5776,0,0]}]"}],"submitted":"98","num_voters":1,"curr_time":1579811938},"comments":[{"cid":"29263","name":"wateronthemoon","uid":"57743","comment":"A great fundamental question, noted in reviewing lab results. +1. (Now if i can only figure out the rules to design something too.)","created":"16 May 2013","picture":"sites\/default\/files\/pictures\/picture-57743.jpg"},{"cid":"29250","name":"ElNando888","uid":"49507","comment":"Voted. Interesting project. Maybe in a subsequent experiment, it could be expanded to the more generic GNRA form. Which prompts me that R (or Y or M) constraints on individual bases do not exist (yet). I'll try to not forget to ask for it in the upcoming dev chat.","created":"15 May 2013","picture":"sites\/default\/files\/pictures\/picture-49507.png"}],"supercomments":[{"cid":"29247","name":"Omei","uid":"57675","comment":"Seems like it isn't possible to tell with the current UI, but the puzzle submission has all the tetraloops locked into a GAAA sequence.","created":"15 May 2013","picture":"sites\/default\/files\/pictures\/picture-57675.png"}],"num_synthesized":40},"memcache":true}